ID: 996681624

View in Genome Browser
Species Human (GRCh38)
Location 5:126233726-126233748
Sequence CCTTCTGTTCTCAAGGTATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996681624_996681629 11 Left 996681624 5:126233726-126233748 CCAAATACCTTGAGAACAGAAGG No data
Right 996681629 5:126233760-126233782 TGCATTTATTCAACAAATATTGG No data
996681624_996681630 20 Left 996681624 5:126233726-126233748 CCAAATACCTTGAGAACAGAAGG No data
Right 996681630 5:126233769-126233791 TCAACAAATATTGGAACCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996681624 Original CRISPR CCTTCTGTTCTCAAGGTATT TGG (reversed) Intergenic
No off target data available for this crispr