ID: 996684326

View in Genome Browser
Species Human (GRCh38)
Location 5:126263885-126263907
Sequence CAGCAGCAGCAGAAATCTTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996684322_996684326 -6 Left 996684322 5:126263868-126263890 CCCTCCCATTTAAATCACAGCAG No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data
996684319_996684326 30 Left 996684319 5:126263832-126263854 CCCACCTAGTTCAAGGGACTATG No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data
996684323_996684326 -7 Left 996684323 5:126263869-126263891 CCTCCCATTTAAATCACAGCAGC No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data
996684324_996684326 -10 Left 996684324 5:126263872-126263894 CCCATTTAAATCACAGCAGCAGC No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data
996684320_996684326 29 Left 996684320 5:126263833-126263855 CCACCTAGTTCAAGGGACTATGA No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data
996684321_996684326 26 Left 996684321 5:126263836-126263858 CCTAGTTCAAGGGACTATGACTG No data
Right 996684326 5:126263885-126263907 CAGCAGCAGCAGAAATCTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996684326 Original CRISPR CAGCAGCAGCAGAAATCTTG AGG Intergenic
No off target data available for this crispr