ID: 996686426

View in Genome Browser
Species Human (GRCh38)
Location 5:126286498-126286520
Sequence AATATCTACCAGAAAATAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996686423_996686426 14 Left 996686423 5:126286461-126286483 CCACATACGTAAGGAAGAAATAA No data
Right 996686426 5:126286498-126286520 AATATCTACCAGAAAATAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996686426 Original CRISPR AATATCTACCAGAAAATAGA AGG Intergenic
No off target data available for this crispr