ID: 996694261

View in Genome Browser
Species Human (GRCh38)
Location 5:126376528-126376550
Sequence TTGTAACAGCAGGAGAAGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996694261_996694267 -1 Left 996694261 5:126376528-126376550 CCCCACTTCTCCTGCTGTTACAA 0: 1
1: 0
2: 2
3: 25
4: 237
Right 996694267 5:126376550-126376572 AAAAGGACAGGAGCACTCTATGG No data
996694261_996694268 14 Left 996694261 5:126376528-126376550 CCCCACTTCTCCTGCTGTTACAA 0: 1
1: 0
2: 2
3: 25
4: 237
Right 996694268 5:126376565-126376587 CTCTATGGCACCAGATGAACAGG 0: 1
1: 0
2: 0
3: 6
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996694261 Original CRISPR TTGTAACAGCAGGAGAAGTG GGG (reversed) Intronic
900636658 1:3669342-3669364 TTGTCCCATCAGGAGAACTGTGG - Intronic
900907335 1:5568777-5568799 CTGTAAAAGCTGCAGAAGTGGGG + Intergenic
903654567 1:24941483-24941505 TTGTAACAGTAGGACAACGGAGG + Intronic
904672738 1:32178535-32178557 TTGTTACAGCATTAGCAGTGAGG - Intergenic
907241376 1:53083106-53083128 TTGTAGCAGCAGGGGAAGCTGGG + Intronic
910581437 1:88829960-88829982 TTGGAAAAGGAGGAGAAGTATGG + Intronic
910672206 1:89784751-89784773 TTCTAACAGCAGGAAAAGGCAGG - Intronic
911218270 1:95219156-95219178 TGTTAACAGGAGGAGAAGTTGGG - Intronic
911729297 1:101276300-101276322 TAGTAACAGCAAAAGAAGTGGGG + Intergenic
912549995 1:110479328-110479350 TTGTAACAGAATGAGGAATGTGG - Intergenic
913482095 1:119298549-119298571 ATGTAACAGCAACAGAAATGGGG + Intergenic
915612610 1:157006638-157006660 TGGTAACAGCATGGGAAGTCAGG + Intronic
915729257 1:158041590-158041612 TTCTAAGATAAGGAGAAGTGAGG - Intronic
915805069 1:158839619-158839641 TTGGAATAGAAGGAAAAGTGTGG - Intronic
916476764 1:165177058-165177080 TTGTAAGAGTAGGAGAACTAAGG + Intergenic
916910217 1:169338087-169338109 TTATAACAGAAGGAAAAGTTAGG + Intronic
917379284 1:174386132-174386154 TTGTAACGGAAGGAAAGGTGAGG + Intronic
918550489 1:185735979-185736001 TTTCAAAAGCAGGAAAAGTGTGG - Intronic
919745388 1:201005444-201005466 TGGAAACAGAAGCAGAAGTGAGG + Intronic
920714945 1:208331471-208331493 TTGGAACAGCAGGACAGGGGAGG - Intergenic
922871634 1:228906757-228906779 CTGGAAGAGCAGGGGAAGTGAGG + Intergenic
923199731 1:231699662-231699684 TAGTAAGAGCAGAAGAAGGGAGG - Intronic
924054882 1:240115643-240115665 TTGTAATAGCAGGAGGACTGGGG - Intronic
1065403408 10:25332926-25332948 TTAGAGCAGCAGGAGAAGTATGG + Intronic
1065823307 10:29546293-29546315 TTGTAACAGTTAGAGAGGTGGGG + Intronic
1067429242 10:46232124-46232146 TTATGACACCAGGAAAAGTGTGG - Intergenic
1068070534 10:52189295-52189317 ATATACCTGCAGGAGAAGTGGGG - Intronic
1069283461 10:66684191-66684213 TTGTCACCACAGGGGAAGTGTGG + Intronic
1070478978 10:76862477-76862499 TTGCAACAGGAGATGAAGTGTGG + Intergenic
1072739938 10:97903288-97903310 TTGTCACAGCTGGGGAAGGGAGG - Intronic
1073011612 10:100364353-100364375 TTTTAACAGAAGGAAAACTGAGG - Exonic
1074928304 10:118096286-118096308 ATGGAACAGCAGAAAAAGTGAGG - Intergenic
1075014135 10:118897720-118897742 TTGGAACAGAAAGAGGAGTGGGG - Intergenic
1077094794 11:794716-794738 ATGTGGCAGCAGGAGAGGTGGGG - Intronic
1077851522 11:6078093-6078115 TTTTAACATAAGGAGAAGTAGGG - Intergenic
1077949168 11:6936283-6936305 TACTAACATCAGGAAAAGTGGGG + Intronic
1078167342 11:8899916-8899938 ATATAACAGCATGAGAAGGGGGG + Intronic
1078664376 11:13312455-13312477 TTGAAAGGGCAGAAGAAGTGTGG + Intronic
1079441008 11:20514921-20514943 ATGTAAAAGCAGTAGAAGTAAGG - Intergenic
1079564402 11:21864585-21864607 TTGGAATAGCAGAAGAAGAGAGG - Intergenic
1079875502 11:25851661-25851683 TTGCAACGGCATGAGAAGTTTGG + Intergenic
1080112851 11:28588448-28588470 TTTTAAAAGTGGGAGAAGTGGGG - Intergenic
1080556695 11:33423735-33423757 TTGTAACAGAAGGCTGAGTGCGG + Intergenic
1082960760 11:58916686-58916708 TGGTAACAGGAGGAGGACTGGGG - Intronic
1084426091 11:69085275-69085297 TGGAAACAGCAGGTGAGGTGGGG + Exonic
1086427777 11:86703863-86703885 TTGTAAACACAGGAGAAGAGGGG - Intergenic
1089796891 11:120987966-120987988 TTGCAACAGCAACAAAAGTGAGG - Exonic
1090329630 11:125920844-125920866 TTGGCACAGCAGGAGCAGAGAGG + Intronic
1090343883 11:126051573-126051595 TTATGACAGCAGGTGCAGTGGGG - Intronic
1092132039 12:6119455-6119477 TGGGGACAGCATGAGAAGTGGGG - Intronic
1092586147 12:9903376-9903398 TTATAACAGCAAAAGAAGTAAGG + Intronic
1093422121 12:18986150-18986172 TTGTAACAGCATTAAAAGGGTGG + Intergenic
1096780395 12:53988504-53988526 TTGTAAGAGCAGCAGAGGTCAGG - Intronic
1098763614 12:74456574-74456596 GTGTCACAGAAAGAGAAGTGGGG - Intergenic
1099299238 12:80870499-80870521 TTGTAAGAGGAACAGAAGTGGGG + Intronic
1099906850 12:88781434-88781456 TTGTAGCAGCAGTAGACTTGGGG - Intergenic
1100167280 12:91930044-91930066 TTTTAACAGCAGCAAAAATGGGG + Intergenic
1100193309 12:92216386-92216408 TTTGCACAGCATGAGAAGTGGGG + Intergenic
1101224633 12:102675862-102675884 AGGAAACAGCAGGAAAAGTGGGG + Intergenic
1101319443 12:103660390-103660412 AAGTAGCAGCAGGAAAAGTGGGG - Intronic
1105351428 13:19619723-19619745 TAGTTACAGCAAGACAAGTGGGG - Intergenic
1105482327 13:20789838-20789860 TTGTCATAGCAGGATAAGGGTGG - Intronic
1107519567 13:41166241-41166263 TGGTAACAAAAGGAGAACTGGGG - Intergenic
1108508898 13:51136991-51137013 TTGTGACAGCTGGAGAGGAGAGG + Intergenic
1108960707 13:56224783-56224805 ATGTAACAGCAAGAGATTTGGGG - Intergenic
1109571847 13:64203171-64203193 TTGTAACTGAAGGAGAACAGTGG + Intergenic
1109948161 13:69465102-69465124 TTCTAGCAGTAGGAGACGTGAGG - Intergenic
1111231066 13:85344576-85344598 GTGTTACAGCAGGGAAAGTGTGG + Intergenic
1111289603 13:86147588-86147610 TTTTAACAGAATGAGAGGTGGGG - Intergenic
1111393107 13:87625382-87625404 CTGGAACAGCAGGTGAACTGGGG - Intergenic
1113900678 13:113795125-113795147 CTGCAACAGAAGGAGAGGTGTGG - Intronic
1113945124 13:114039682-114039704 CTGTAACAGAGGGAGCAGTGGGG - Intronic
1115309978 14:31969109-31969131 TGGGAACTCCAGGAGAAGTGAGG + Intergenic
1116525367 14:45897461-45897483 TTGCAACAGCAGAATAAATGTGG - Intergenic
1118297150 14:64580969-64580991 TTGTAATATCAGGAGAAAGGAGG + Intronic
1119829801 14:77691956-77691978 TGGTATCAACAGGAGCAGTGAGG - Intronic
1122220602 14:100237040-100237062 TTGTGAGAGCAAGAGAAATGAGG - Intergenic
1122307575 14:100775674-100775696 TGGGCACAGCAGGAGAAGAGTGG - Intergenic
1122874245 14:104656215-104656237 TTCCAACAGCAGGAAAAGGGAGG + Intergenic
1128267530 15:66279723-66279745 TTGTAACAGCAGCAGATATGTGG - Intergenic
1129072222 15:72961053-72961075 TTGTAATTTCAGTAGAAGTGGGG + Intergenic
1129695259 15:77737386-77737408 TTGTAAAAGAAAGAGAAGGGAGG + Intronic
1129777975 15:78249460-78249482 TAGTAACAGAAGGAAGAGTGCGG - Intergenic
1131903337 15:97113113-97113135 GTCTAATAGCAGCAGAAGTGTGG + Intergenic
1135007722 16:18841977-18841999 TTGTACAAGCAGGACAAGTGAGG - Intronic
1137822011 16:51455093-51455115 TTGTCACATCAGGAGAAGGAGGG + Intergenic
1138258533 16:55594225-55594247 TAGAAACAGCAGGTGAAATGTGG + Intergenic
1141586762 16:85039152-85039174 CTATAGCAGCAGGAGAATTGAGG - Intronic
1143765767 17:9136804-9136826 TTGTGGCAGGAGGAGAGGTGAGG - Intronic
1145185352 17:20789144-20789166 TTTTAACAGAAGGAAAACTGAGG - Intergenic
1145802038 17:27693721-27693743 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1148578274 17:48726322-48726344 TGGTAACAGCAGGAAGACTGAGG - Exonic
1150419804 17:65022810-65022832 TTGTAACAGCTGAAGAAATATGG + Intronic
1154205839 18:12335982-12336004 TTATAACAGCAAGAGAAATTTGG + Intronic
1155064545 18:22257169-22257191 GAGTAACAGCAGCAGAAGAGTGG - Intergenic
1155576042 18:27248056-27248078 CTATAACAGCAGTGGAAGTGGGG - Intergenic
1159553580 18:69922115-69922137 TTCTAACAGCATCAGAAATGTGG + Intronic
1163205216 19:15797580-15797602 TTGAAACAACCGGAGAAGTTGGG + Intergenic
1166230752 19:41424827-41424849 CTGTAACAACAGGTGAAGAGGGG - Exonic
1167971714 19:53192065-53192087 GAGAAACAGCAGGAGAAGAGAGG - Intronic
926531322 2:14049738-14049760 TTATAACAGGAGGTGAAATGTGG + Intergenic
926556485 2:14363951-14363973 TAGTAACAGAAGGACAAGGGAGG - Intergenic
929084850 2:38158179-38158201 TTGTCAGAGGAGGAAAAGTGTGG + Intergenic
929317179 2:40493607-40493629 TTGTAATAGAGGGAGAAGTGTGG - Intronic
930040992 2:47123883-47123905 TAGTAACAGCAGGATAAATGGGG + Intronic
930794388 2:55372677-55372699 TGGTAACAGCAGAAGAAATGGGG + Intronic
931190267 2:59993515-59993537 GTGTAACAGCAGAACATGTGTGG - Intergenic
932150883 2:69370765-69370787 GTGAGAAAGCAGGAGAAGTGTGG + Intronic
932454270 2:71836547-71836569 TAGTTACAGAAGGAGATGTGAGG - Intergenic
933041110 2:77468059-77468081 TTGTAACAGCATGAAAACTTTGG - Intronic
933594828 2:84272945-84272967 ATGAAGCAGCAGGGGAAGTGTGG - Intergenic
934036629 2:88093787-88093809 TTGGAAGAGCAGTGGAAGTGAGG - Intronic
935585242 2:104795095-104795117 TTTTATCATCAAGAGAAGTGAGG + Intergenic
936235118 2:110735748-110735770 TTGTGACAGCAGGAGCATTCTGG + Intronic
937417026 2:121723599-121723621 TTCCAACAGCAGAAGAAATGTGG - Intergenic
937627865 2:124064059-124064081 TTGTAAAAAGAGGAGAAGTATGG + Intronic
940322239 2:152389801-152389823 TTTTCACTGCAGGAGAAGAGGGG + Intronic
942737912 2:179137627-179137649 CTGTAACAGCAGCAGCAGTATGG + Intronic
945882512 2:215340996-215341018 CTGTAACAGAAGGAGATGAGGGG + Intronic
946484061 2:220084160-220084182 TTGTGAATGCAGCAGAAGTGAGG - Intergenic
948267197 2:236643609-236643631 TGGTAACATGAGGAGAACTGTGG - Intergenic
1168783282 20:513659-513681 TTGAAACAGCAGAAGAAGACTGG - Intronic
1168838680 20:894916-894938 TTGCAACCACAGGACAAGTGGGG - Intronic
1171299742 20:24050046-24050068 TTGTCACAGCAGCTGAAGGGTGG - Intergenic
1175704305 20:61164712-61164734 TTGTCACAGCTGGAGAAGAGTGG + Intergenic
1175786822 20:61717195-61717217 CTGTGACAGCAGCAGCAGTGGGG - Intronic
1176902305 21:14457588-14457610 TTGGAATAGGAGGAGAAGAGGGG - Intergenic
1176927786 21:14771103-14771125 TGGTAGCAGAAGGAGAAGTAAGG + Intergenic
1177250910 21:18589832-18589854 TTGTAACAGCAGTGGTATTGAGG - Intergenic
1178501560 21:33129845-33129867 TTGAAACAACTAGAGAAGTGTGG - Intergenic
1178580166 21:33831592-33831614 TTGGAACAGCAGGAGCAGGAAGG + Intronic
1178790459 21:35694855-35694877 TTGTAACAGCAAAAGCAGAGGGG + Intronic
1179352825 21:40629486-40629508 ATGAAACAAGAGGAGAAGTGAGG + Intronic
1181024760 22:20121778-20121800 TTGTGACTGTAGGAGCAGTGGGG + Intronic
1181287874 22:21767480-21767502 TGTTAACAGCAGGCTAAGTGAGG + Intronic
949747163 3:7308352-7308374 TTCCAACAGTAGGAGATGTGTGG - Intronic
951094133 3:18608799-18608821 TTGTAATAGCAAGAAAAATGTGG - Intergenic
954008534 3:47613786-47613808 TTTTGAAAGCAGGGGAAGTGGGG - Intronic
954173089 3:48821067-48821089 CTGTAACAGTAGGACAAGGGTGG + Intronic
954573155 3:51659019-51659041 GTGTTACAGCAGCAGAATTGAGG + Intronic
958080530 3:88740853-88740875 TTATAAAAAAAGGAGAAGTGTGG + Intergenic
958872603 3:99578856-99578878 TAGTAACAGAAGGGGAAGTCAGG - Intergenic
959402673 3:105922143-105922165 TTTTCACAGTAGGAAAAGTGAGG - Intergenic
961140496 3:124551735-124551757 ATGTGACAACAGGAGAAATGAGG - Intronic
963864927 3:150350221-150350243 ATTTCACAGCAGGAGAAGTGGGG - Intergenic
963880285 3:150520673-150520695 TTGTAAAAGCCGGAGAAGCGAGG - Intergenic
963912110 3:150823698-150823720 AAGTCAAAGCAGGAGAAGTGAGG + Intergenic
964570099 3:158101711-158101733 TTGTAACAGCTGCAGATGTGCGG + Intronic
964624856 3:158749022-158749044 TGGGCACAGCAGGAGAAGAGGGG - Intronic
964893720 3:161568635-161568657 CTGTAACAGAGGCAGAAGTGTGG - Intergenic
965813220 3:172613154-172613176 TTGTAACAGGAGAAGAACTGTGG - Intergenic
967222000 3:187255186-187255208 TGGTAGCAGCAGCAGAAGTCAGG + Intronic
968442902 4:633558-633580 TAGAAACAGCAGGAGATGTGAGG + Intronic
969222162 4:5768074-5768096 TTGCAGCAGCAGCAGCAGTGAGG + Intronic
969658892 4:8514844-8514866 TAGTAAGAGCAGCAGCAGTGTGG + Intergenic
970469578 4:16363383-16363405 TTTTCAGAGCAGGTGAAGTGAGG + Intergenic
971329834 4:25673366-25673388 TTGGATCAGCACCAGAAGTGAGG + Intronic
972312983 4:37898737-37898759 TTCTACCAGCAGGATAACTGTGG + Intronic
972664745 4:41154158-41154180 TTCAAACAGCTGGAGAACTGGGG - Intronic
972717301 4:41659850-41659872 TTGTAATAGCAGGATAATTTTGG + Intronic
974052494 4:56953964-56953986 TTGTAACAGCTGAGCAAGTGAGG - Intergenic
975546327 4:75564056-75564078 TGGTAACAGAAGCAGAAGAGTGG - Intronic
976911272 4:90309175-90309197 TTGTAACAGCAGCAGAATTGAGG - Exonic
978410141 4:108416982-108417004 TGGTTGCAGAAGGAGAAGTGAGG - Intergenic
979422540 4:120523181-120523203 TAATCACAGCAGGAGAAATGGGG - Intergenic
979932100 4:126643449-126643471 TTAAAACAGCTGGAGAACTGGGG + Intergenic
981595168 4:146412733-146412755 TTAGAACAGGAGGAGAAATGGGG + Intronic
986007672 5:3681710-3681732 TTCTATCCTCAGGAGAAGTGTGG - Intergenic
986032487 5:3907221-3907243 TTGTAAAAGCAATAGAGGTGGGG - Intergenic
986309395 5:6541037-6541059 GTGCTACAGCAGGATAAGTGAGG + Intergenic
986576478 5:9218587-9218609 TTGTCTCAGCAGGAGAAGTTGGG - Intronic
989133293 5:38128561-38128583 TTGGAACAGCATGATTAGTGAGG - Intergenic
989716357 5:44468039-44468061 TTGTAACAGCAGTGGCAGTGTGG + Intergenic
990630173 5:57660081-57660103 TTCTTACAGAAGGAGAAGTGAGG + Intergenic
991985442 5:72281164-72281186 TTGTAACATCGGGAGAAGCAAGG - Intronic
993291099 5:86071675-86071697 TTCTATCAGCTGAAGAAGTGAGG + Intergenic
994408563 5:99377704-99377726 TTGTAAAATTAGGAGAACTGAGG - Intergenic
996569707 5:124919281-124919303 TTCTACCAGAATGAGAAGTGTGG - Intergenic
996694261 5:126376528-126376550 TTGTAACAGCAGGAGAAGTGGGG - Intronic
997090540 5:130851284-130851306 TTGTAATAACAGGAAAACTGTGG + Intergenic
998586833 5:143435834-143435856 TTGTAACAGTGGAACAAGTGAGG + Intergenic
998807517 5:145933388-145933410 TGGGAACAGCGGGAGAAGGGAGG + Intergenic
998832127 5:146170981-146171003 TTGTAACTACAGGTGAAGGGTGG + Intronic
1000157388 5:158564941-158564963 TTGTCACAGCAAGGGAAGAGAGG + Intergenic
1000977643 5:167782593-167782615 TTGTAAATGCAAGAGAAGGGAGG + Intronic
1001538043 5:172513503-172513525 TTGTATCTGTAAGAGAAGTGAGG + Intergenic
1003339997 6:5211173-5211195 TTGTAAAAGGATGAGAACTGTGG + Intronic
1003424947 6:5992787-5992809 TGGAAACTGCAGGAGCAGTGGGG + Intergenic
1004521102 6:16361701-16361723 TTGTAGGAGGAGGAGAAGTTTGG - Intronic
1004938195 6:20528734-20528756 TGGTAACAGCAGAGGAATTGGGG - Intergenic
1005913949 6:30335702-30335724 TTGTATCAGCAGGGTCAGTGTGG - Intronic
1006683582 6:35814435-35814457 TGTTAACAGAAGGAGAAGGGAGG + Intronic
1007700267 6:43762297-43762319 TGGAAGCATCAGGAGAAGTGAGG - Intergenic
1008289109 6:49691240-49691262 TTGTAACTGCAAGAGCACTGAGG - Intergenic
1008778628 6:55073025-55073047 TTGGATCTGCAAGAGAAGTGAGG + Intergenic
1008790900 6:55231944-55231966 TGATCACAGCAGGAGGAGTGAGG - Intronic
1009852521 6:69215806-69215828 TTGTTAGAGGAGGAGAAGAGTGG + Intronic
1010092436 6:72000572-72000594 ATAGAACAGCAGTAGAAGTGGGG - Intronic
1010492741 6:76494382-76494404 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1012114504 6:95278534-95278556 TGGTAACTGCTGGAGAAGTGAGG - Intergenic
1013599900 6:111693938-111693960 TTGTAACAGCAACAGAACTAAGG - Intronic
1013817206 6:114112704-114112726 TTGGAGGAGAAGGAGAAGTGTGG - Intronic
1016449810 6:144170481-144170503 TTGTCACAGGAGGTCAAGTGTGG + Intronic
1017969421 6:159298851-159298873 AAGGAACAGGAGGAGAAGTGGGG - Intergenic
1018920553 6:168169334-168169356 TTGTAACCACAGGAGTAATGTGG - Intergenic
1020195910 7:6038909-6038931 TTGTAATACCAGCAGAAGGGGGG + Intronic
1020456447 7:8378938-8378960 TTGTAACAGCAGGATAACAAAGG + Intergenic
1020959045 7:14779241-14779263 TTGTAAAAGCAGGTGGAGAGGGG + Intronic
1021504051 7:21361281-21361303 CTGTAAAAGAGGGAGAAGTGAGG - Intergenic
1022200456 7:28111812-28111834 TGTTACCAGCAGGAGAAGTAGGG + Intronic
1022310280 7:29190576-29190598 TTGTAACAGCCGGTGAAGGAGGG + Intronic
1026184083 7:68067953-68067975 TTGTAACAGCTGGAGAAATGCGG - Intergenic
1030642178 7:112018501-112018523 TTGGAAGAGCAGAAGAAGAGAGG - Intronic
1031780784 7:125961458-125961480 ATGGAACAGCAGGAGGAGGGAGG - Intergenic
1033306967 7:140231847-140231869 TTTTACCAGCAGGGGAAGTGAGG + Intergenic
1034688931 7:152998521-152998543 TTGTCCCAGCAGGAGCAGTCAGG + Intergenic
1034859231 7:154581880-154581902 TTCTAGCAGCAGGAGAAGGCAGG - Intronic
1034928548 7:155142502-155142524 TTGTAACAATATGAAAAGTGTGG + Intergenic
1035215665 7:157364688-157364710 TAGTAACATTAGGAAAAGTGAGG + Intronic
1036153147 8:6317070-6317092 TTTCAACAGCAGCAGAAGTTTGG + Intergenic
1037594814 8:20346117-20346139 ATAGAAAAGCAGGAGAAGTGGGG - Intergenic
1038457553 8:27687358-27687380 TGGTTAGAGCAGGGGAAGTGTGG - Intergenic
1039892182 8:41693202-41693224 CTGTAACAGCGGCAGAAATGGGG + Intronic
1041252325 8:55946349-55946371 TTGTAACAGTAGCAGATGTTAGG - Intronic
1041871900 8:62644207-62644229 TAGTAGCAGCAGGAGCAGTGAGG - Intronic
1042899044 8:73703288-73703310 TGGTAAAAGCAGGAGCAATGTGG - Intronic
1043770573 8:84194243-84194265 CTGTAACAGGATGACAAGTGAGG + Intronic
1044142824 8:88675600-88675622 TTTTAACATGAGGAGAAGTAGGG + Intergenic
1045968397 8:108052735-108052757 TTTTAAAAGCAGGAAAACTGAGG + Intronic
1048342743 8:133553442-133553464 TTTGAACAGCAGGTAAAGTGAGG - Intronic
1048527103 8:135213243-135213265 TCAAAACAGCAGGAGAAGTGAGG - Intergenic
1050103577 9:2143282-2143304 TTTTAACAGCAGTAGATGTGGGG + Intronic
1051710285 9:19924385-19924407 TGGTAACTGCAGGAGAAATGGGG - Intergenic
1051912134 9:22165154-22165176 TTGTTAAAGCAGGAGGAGGGAGG + Intergenic
1053602080 9:39620986-39621008 GTGTACCAGCAGAACAAGTGTGG - Intergenic
1053859737 9:42374750-42374772 GTGTACCAGCAGAACAAGTGTGG - Intergenic
1054565567 9:66755965-66755987 GTGTACCAGCAGAACAAGTGTGG + Intergenic
1054934832 9:70676020-70676042 TTGTCACAGCAGGAACAATGTGG - Intronic
1055285515 9:74724472-74724494 TTTGAACAGAAGGAGATGTGAGG + Exonic
1055593875 9:77846226-77846248 TTGAAAAATCAGGAGATGTGTGG + Intronic
1056434384 9:86561348-86561370 TTGGTTCTGCAGGAGAAGTGAGG + Intergenic
1056875648 9:90327418-90327440 TTGTTAGAGGATGAGAAGTGAGG - Intergenic
1059786752 9:117594439-117594461 CTGTATCAGCAGGAGAAGAAAGG + Intergenic
1060127936 9:121067787-121067809 TTGAAGCAGCAGGAGGAGAGGGG - Intergenic
1060271360 9:122144461-122144483 TTGTAGCAGCGGGAGCAATGAGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060739286 9:126087677-126087699 TTGTAACAGTATTAGAGGTGGGG - Intergenic
1061007294 9:127935384-127935406 ATGTGACAGGAGGGGAAGTGAGG + Exonic
1061012144 9:127961996-127962018 TGGTCACAGCAGCAGAAGTTGGG + Intronic
1186842163 X:13495094-13495116 TTGTCACAGCTGGGGAAGTGGGG + Intergenic
1188259877 X:28009606-28009628 TTATAAAAGGAGGAGAAGAGAGG + Intergenic
1189577232 X:42367232-42367254 TTGAAAAAGCAAGAGAAATGAGG - Intergenic
1191580842 X:62759049-62759071 TGGTAACAATAAGAGAAGTGTGG - Intergenic
1192780314 X:74287398-74287420 CTGTAACATCAAGAGAGGTGAGG + Intergenic
1192887886 X:75355860-75355882 TTGTAACAGGAGGCAAAATGAGG - Intergenic
1195974876 X:110515721-110515743 TAGAAACAGCAGCAGAGGTGAGG - Intergenic
1196745339 X:119066824-119066846 TTGTAACCGGAGGATAAGGGTGG - Intergenic
1196835524 X:119810383-119810405 GTGTAACAGGAGGTGAAATGTGG + Intergenic
1197641774 X:128975692-128975714 GTGTAGCAGAAGGAGAAGTGTGG - Intergenic
1197971641 X:132120692-132120714 ATGTGACAGCAGGAGATGTGGGG + Intronic
1199716012 X:150507825-150507847 AGGAAACAGCAGGGGAAGTGCGG - Intronic
1201288286 Y:12397769-12397791 TTGTAAGATGAGGAGAAGAGAGG - Intergenic
1202247256 Y:22832859-22832881 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1202400245 Y:24466607-24466629 TTTTAACATAAGGAGAAGTAGGG + Intergenic
1202470536 Y:25203479-25203501 TTTTAACATAAGGAGAAGTAGGG - Intergenic