ID: 996694582

View in Genome Browser
Species Human (GRCh38)
Location 5:126379786-126379808
Sequence ACTGATATCCAGAATGTACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 9601
Summary {0: 3, 1: 43, 2: 989, 3: 3864, 4: 4702}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996694582_996694585 24 Left 996694582 5:126379786-126379808 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 996694585 5:126379833-126379855 AAGATTTTCTCCCACTCTGTGGG 0: 726
1: 1318
2: 13033
3: 17048
4: 10056
996694582_996694584 23 Left 996694582 5:126379786-126379808 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 996694584 5:126379832-126379854 GAAGATTTTCTCCCACTCTGTGG 0: 654
1: 876
2: 840
3: 2663
4: 3826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996694582 Original CRISPR ACTGATATCCAGAATGTACA AGG (reversed) Intronic
Too many off-targets to display for this crispr