ID: 996694584

View in Genome Browser
Species Human (GRCh38)
Location 5:126379832-126379854
Sequence GAAGATTTTCTCCCACTCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8859
Summary {0: 654, 1: 876, 2: 840, 3: 2663, 4: 3826}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996694582_996694584 23 Left 996694582 5:126379786-126379808 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 996694584 5:126379832-126379854 GAAGATTTTCTCCCACTCTGTGG 0: 654
1: 876
2: 840
3: 2663
4: 3826
996694583_996694584 0 Left 996694583 5:126379809-126379831 CCTTTGTCAGATGTATAGATTGT 0: 448
1: 791
2: 4597
3: 12212
4: 14506
Right 996694584 5:126379832-126379854 GAAGATTTTCTCCCACTCTGTGG 0: 654
1: 876
2: 840
3: 2663
4: 3826

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996694584 Original CRISPR GAAGATTTTCTCCCACTCTG TGG Intronic
Too many off-targets to display for this crispr