ID: 996694585

View in Genome Browser
Species Human (GRCh38)
Location 5:126379833-126379855
Sequence AAGATTTTCTCCCACTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 42181
Summary {0: 726, 1: 1318, 2: 13033, 3: 17048, 4: 10056}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996694583_996694585 1 Left 996694583 5:126379809-126379831 CCTTTGTCAGATGTATAGATTGT 0: 448
1: 791
2: 4597
3: 12212
4: 14506
Right 996694585 5:126379833-126379855 AAGATTTTCTCCCACTCTGTGGG 0: 726
1: 1318
2: 13033
3: 17048
4: 10056
996694582_996694585 24 Left 996694582 5:126379786-126379808 CCTTGTACATTCTGGATATCAGT 0: 3
1: 43
2: 989
3: 3864
4: 4702
Right 996694585 5:126379833-126379855 AAGATTTTCTCCCACTCTGTGGG 0: 726
1: 1318
2: 13033
3: 17048
4: 10056

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996694585 Original CRISPR AAGATTTTCTCCCACTCTGT GGG Intronic
Too many off-targets to display for this crispr