ID: 996695240

View in Genome Browser
Species Human (GRCh38)
Location 5:126387138-126387160
Sequence AAATATGGACTTCAGTCATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 208}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996695240_996695242 -1 Left 996695240 5:126387138-126387160 CCATATGACTGAAGTCCATATTT 0: 1
1: 0
2: 0
3: 18
4: 208
Right 996695242 5:126387160-126387182 TTGATGACCTTAAGTAAACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996695240 Original CRISPR AAATATGGACTTCAGTCATA TGG (reversed) Intronic
904289794 1:29477616-29477638 AAACATGGACCTCAGTTATGCGG - Intergenic
905482367 1:38270457-38270479 GAAGATGGACTTGAGTCAGAAGG - Intergenic
907512968 1:54975981-54976003 AAATGAGGACCTCAGTCCTATGG + Intergenic
907951131 1:59185192-59185214 AAATCTGGGCTACAGGCATAAGG - Intergenic
909160243 1:72138059-72138081 AAAAAAGTACTTCAGGCATAAGG + Intronic
909272164 1:73637009-73637031 CACTCTGGACTTCAGGCATAAGG - Intergenic
911760234 1:101605593-101605615 AATAATGGAGTTCAGACATATGG - Intergenic
912617622 1:111121076-111121098 AAATATAAACTTCAGAAATAAGG + Intronic
912721788 1:112026429-112026451 CAAAATGGAATTCAGTCATATGG - Intergenic
912782561 1:112565410-112565432 AAATATGTACTCCAGTTATAAGG + Intronic
918525212 1:185457058-185457080 AAATAGAGAGTTAAGTCATACGG - Intergenic
919108943 1:193192589-193192611 AAATAGGGACTTCAGTGTAAAGG + Intronic
919131494 1:193456495-193456517 CTCTATGGACTTCATTCATATGG - Intergenic
919302566 1:195789710-195789732 AAATTTGGACTTCAGTCACTGGG - Intergenic
919723113 1:200862060-200862082 AAGTATCAATTTCAGTCATAAGG - Intergenic
923822104 1:237456323-237456345 AAATATGTACTTCATACTTATGG - Intronic
1064917020 10:20470351-20470373 AAATATGTACTTTAATCCTAAGG + Intergenic
1066780122 10:38936214-38936236 TTATAAGGACATCAGTCATATGG - Intergenic
1067203506 10:44194823-44194845 TTATAAGGACTCCAGTCATATGG + Intergenic
1067400349 10:45967769-45967791 AAAAATGAGCTTCAGTCAGAGGG + Intergenic
1067868673 10:49937062-49937084 AAAAATGAGCTTCAGTCAGAGGG + Intronic
1068104398 10:52595129-52595151 GAATATGGACTTGAATCAAATGG - Intergenic
1070724650 10:78779833-78779855 AAATACAAACTTCAGTCAGATGG - Intergenic
1071117590 10:82240700-82240722 AGATTTGGATTTCAGTCAAATGG + Intronic
1071376117 10:85006415-85006437 AAATGTGAATTTGAGTCATATGG - Intergenic
1071719956 10:88133050-88133072 AAAAATGGTCTTCAGTCTGAGGG + Intergenic
1073093235 10:100962720-100962742 CAATATAGACTTCTGTAATATGG - Intronic
1073881282 10:107983323-107983345 AAATGTGGACTTCAGCAACATGG - Intergenic
1075016457 10:118913339-118913361 AAATTTAGACCTCAGTCACAAGG + Intergenic
1075959866 10:126559010-126559032 AGAGATGGACTTCAGTGATGTGG - Intronic
1079313656 11:19389307-19389329 AGATAGAGACTTCAGTCTTATGG + Intronic
1079389510 11:20009246-20009268 AAATTTGGATTTGAGTCAAATGG + Intronic
1080023321 11:27587378-27587400 AAAAATGGCCTTCAGATATATGG - Intergenic
1080839346 11:35969858-35969880 AAATATTTACTTCAGTGACATGG + Intronic
1080932125 11:36821892-36821914 AAATGTGGACATCAGTCCTCTGG + Intergenic
1081378169 11:42384399-42384421 TAATATTGACCTCAGTCATTTGG - Intergenic
1084341987 11:68510817-68510839 AAATACAGTCTTCAGACATATGG - Intronic
1085007113 11:73102033-73102055 AAATATGGTCTTCAGCCTGATGG - Intronic
1086188455 11:84049421-84049443 AAACATGGGCTTCACTCATACGG + Intronic
1086955626 11:92932185-92932207 AAATCTGGAGTTCAGTCAGCAGG - Intergenic
1087337828 11:96866549-96866571 ACATATGGTCTTCAGTGATCTGG + Intergenic
1088641276 11:111875463-111875485 AAATTTGTCCTTCAGTCAAATGG - Exonic
1092220769 12:6711666-6711688 ACATATGAACTGCAGTCACATGG - Intergenic
1092698380 12:11199573-11199595 CTATATGGATTTCAGTCAGAGGG - Intergenic
1093424968 12:19018522-19018544 AAATCTGGACTTTATTCAAAAGG + Intergenic
1094046840 12:26176980-26177002 AAATTTGGACTTTATTCTTAAGG - Intronic
1095334168 12:41006824-41006846 AAACATGGACTTCATCCAGATGG + Intronic
1095343503 12:41120743-41120765 AAATATGGAGCTCAATTATAAGG - Intergenic
1097285942 12:57877438-57877460 AAATATTGACTTTATTCAAAAGG + Intergenic
1097424141 12:59420945-59420967 AAATTTGCATTTCATTCATAAGG + Intergenic
1098466243 12:70789730-70789752 AATTATGGACTCAAGTTATATGG + Intronic
1101438375 12:104683533-104683555 AAATATGGTATTCAGAAATATGG + Intronic
1102794558 12:115677272-115677294 AAACATGGACCTAAGTCGTAGGG + Intergenic
1103041333 12:117697926-117697948 TTATAGGGACATCAGTCATATGG - Intronic
1106954082 13:34916302-34916324 ACATATGGACTTAAGATATAGGG - Intergenic
1107490306 13:40875146-40875168 AAATTTGGACTTATGTAATAAGG - Intergenic
1108444303 13:50491896-50491918 AAGTATGGAGTCCATTCATAAGG + Intronic
1108702027 13:52951947-52951969 AAAAAATGAGTTCAGTCATATGG + Intergenic
1112407419 13:99133748-99133770 GAATATGGAATTCAGTCAGGTGG + Intergenic
1112665469 13:101567193-101567215 AAATACCAACTTCAGTAATATGG - Intronic
1115183601 14:30658112-30658134 AGCTGTGGACTTCAGTCAAAGGG + Intronic
1116661026 14:47710333-47710355 AAATATGGACTTCAATAAGAGGG + Intergenic
1121388188 14:93550044-93550066 AAACATGGACTTCAGAGAAACGG + Intronic
1123013657 14:105362527-105362549 AAAAATGTATTTCATTCATAAGG - Intronic
1126558424 15:50016800-50016822 AAATATGTTCTGCAGTCCTAAGG + Intronic
1127402490 15:58603596-58603618 AAATATGGCCATCAGTGTTATGG + Intronic
1127660910 15:61099270-61099292 CAATATGGAATTCAGTAATGAGG + Intronic
1127923987 15:63520391-63520413 AAATTTGAACTTGAGTTATAAGG - Intronic
1129889397 15:79061140-79061162 AAACAGGGACTTCAGTCCCATGG + Intronic
1138060462 16:53884731-53884753 ATATCTGGACTTCAGTCATTGGG - Intronic
1138987840 16:62352823-62352845 AAATTTGGATTACAGTCCTAAGG - Intergenic
1140636586 16:76922057-76922079 ATACATGAACTTCTGTCATAGGG + Intergenic
1140840822 16:78837459-78837481 AAATATGGATGTCACTTATAAGG + Intronic
1141379504 16:83563613-83563635 AAACTTGCACTTCAGTCAAAAGG - Intronic
1144158467 17:12533133-12533155 AAATTTCAACTTCAGACATATGG - Intergenic
1145070562 17:19802024-19802046 AAATATGTAATACAGTCACATGG + Intronic
1145846868 17:28046573-28046595 AAATAGTAACTTCAGTCATTTGG + Intronic
1148286349 17:46396324-46396346 AAATAGGGAATTCAGTCAAAAGG + Intergenic
1148308515 17:46613916-46613938 AAATAGGGAATTCAGTCAAAAGG + Intronic
1150551504 17:66215065-66215087 AAAAATTGCCTTCAGCCATAGGG + Intronic
1150899095 17:69250852-69250874 AAGTATGGAGTTCAGTGACAAGG - Intronic
1152106691 17:78334026-78334048 AAAAATGGAATCCAGTAATATGG - Intergenic
1153451614 18:5237270-5237292 AAACATGGACTGCATTCATCTGG + Intergenic
1155647633 18:28098923-28098945 AGATATGGACTTCACAAATAAGG + Intronic
1155786220 18:29904140-29904162 AAATATTTATTTCTGTCATATGG + Intergenic
1156196092 18:34775669-34775691 GAATAGGGACCTCAGTCCTATGG + Intronic
1158700812 18:59744436-59744458 AAATATGCATTTTAGACATATGG - Intergenic
1159771550 18:72551572-72551594 ACATATAGACTTCAGTGATGGGG - Intronic
1164005908 19:21149196-21149218 AAATAAGGCCTTGAGACATATGG - Intronic
931399594 2:61918888-61918910 AAATTTGGACTTCTGTTATGTGG + Intronic
931424097 2:62155063-62155085 TTATAAGGACATCAGTCATATGG + Intergenic
933509987 2:83228379-83228401 AAATATGGATTTTATTCAAAAGG + Intergenic
935468199 2:103424971-103424993 TTATAAGGACATCAGTCATATGG - Intergenic
938491323 2:131762745-131762767 CCATGTGGACTTTAGTCATAAGG - Intronic
938496239 2:131799581-131799603 CCATGTGGACTTTAGTCATAAGG + Intronic
943029334 2:182668020-182668042 ACCCATGGACTTCAGTCAAAGGG + Intergenic
943535452 2:189143439-189143461 AAATATTGACCTCAGTTACAGGG - Intronic
944045501 2:195406797-195406819 ATATTTGGACTTCAGATATATGG - Intergenic
944066839 2:195627946-195627968 AAATATGGACCTCTGGTATAAGG + Intronic
944773953 2:202942926-202942948 CAATATGAACTTCAGTCATTGGG + Exonic
945585988 2:211663507-211663529 AAATCTGGATCTCAGTCAAAAGG - Intronic
948217945 2:236245542-236245564 AAATAAGGACTGCAGGCAGAAGG - Intronic
1172856766 20:38010435-38010457 AATTTTGGACTTCAATTATAAGG - Intronic
1174456333 20:50651243-50651265 AAATGGGGACCTCAGTCCTATGG + Intronic
1174555432 20:51392005-51392027 AAAAATGGATTTGAGCCATAGGG + Intronic
1175645056 20:60663988-60664010 AAATATGGCTTTGAGGCATAGGG - Intergenic
1176708453 21:10131615-10131637 CCATGTGGACTTTAGTCATAAGG - Intergenic
1178577928 21:33811612-33811634 AAAAATTGAATTCAGTCATGTGG + Intronic
1180747052 22:18096782-18096804 AAATATGCAATACATTCATAGGG + Exonic
1184303402 22:43577571-43577593 AAAGATGGACTTAACTCAGAGGG + Intronic
1203237923 22_KI270732v1_random:24720-24742 TTATAAGGACATCAGTCATATGG - Intergenic
1203289733 22_KI270735v1_random:23643-23665 TTATAAGGACATCAGTCATATGG + Intergenic
949149489 3:748078-748100 AAATATATAATACAGTCATACGG - Intergenic
951562867 3:23985698-23985720 AAACATGGAGTTCTGTAATAAGG + Intergenic
952560385 3:34585813-34585835 AAATATAGACATCAGTTTTAAGG - Intergenic
956964546 3:74443590-74443612 ACATCTGCACTTCAGTCAGATGG + Intronic
957544718 3:81622730-81622752 AAAATGGGACTTCTGTCATAAGG - Intronic
960692861 3:120365312-120365334 AAATATGGACTCCAGTAGGAAGG - Intergenic
962303459 3:134264763-134264785 AAAGATGAACTTCAGGCAAAAGG - Intergenic
963380035 3:144517310-144517332 AATTAAGGAATTCATTCATAGGG - Intergenic
963588858 3:147230418-147230440 AAATATGTCCTTTAATCATATGG - Intergenic
963809484 3:149761105-149761127 AAATATGTTCTACATTCATATGG + Exonic
963817024 3:149842549-149842571 AAATATGGAATTTATACATATGG - Intronic
964885184 3:161473910-161473932 AAATATGGCTTTCTGGCATAAGG - Intergenic
965462974 3:168991779-168991801 AAATCTGGATATCAGTCAGATGG + Intergenic
965609490 3:170529788-170529810 TTATAAGGACATCAGTCATATGG - Intronic
967977522 3:195043858-195043880 AAATATCGATTGCATTCATATGG - Intergenic
969276836 4:6141532-6141554 AAATATTGACTACAGTCCTTAGG + Intronic
969410520 4:7025139-7025161 CAAGATGGACTTCATTCACATGG + Exonic
972076641 4:35098433-35098455 AAATAAGGAGTTCATTCATAAGG - Intergenic
974390132 4:61256050-61256072 AAATATGGTCTTTAGTCAAAGGG + Intronic
974918855 4:68211487-68211509 AAATATGGAATTCAGGCATTAGG + Intergenic
975706682 4:77118958-77118980 AAATATGTCATTCAGTAATAAGG - Intergenic
975834180 4:78404279-78404301 AAATATAGACTTCAGTATAAAGG + Intronic
976869463 4:89773222-89773244 AAATGTGGACTTCAGTTTTGTGG + Intronic
976882120 4:89939771-89939793 AAATATCGGCTCCAGCCATATGG - Intronic
976937656 4:90658359-90658381 CAAGATGGACGTCAGTCATTGGG + Intronic
981380336 4:144064076-144064098 AACTATGGAACACAGTCATAAGG + Intergenic
982792116 4:159605174-159605196 AAACATGGACTTCAAACAAATGG - Intergenic
985329504 4:188814651-188814673 AAAAATGTACTTCAGGCACAAGG + Intergenic
986166283 5:5274208-5274230 AACTATGGACTTGGGTGATAGGG - Intronic
987012520 5:13781962-13781984 AAACATGGACTTCTGCCACAAGG - Intronic
987581759 5:19803605-19803627 AAATCCAGACTTCAGTCATTTGG + Intronic
988032930 5:25789107-25789129 AATTATAGACTTCAGCCAAAGGG + Intergenic
989250484 5:39308754-39308776 CAATATGGACTTACTTCATAAGG - Intronic
990069903 5:51768576-51768598 AAATATTAATTTCAGTCAAATGG + Intergenic
990517024 5:56539728-56539750 GAACAAGGACTTCAGTCCTATGG + Intronic
990963324 5:61417661-61417683 AAGTATGCACTTCAGTGGTAAGG - Intronic
991286305 5:64980357-64980379 GCATATGGACTTCATCCATATGG - Intronic
993194318 5:84721404-84721426 AAAAATGGAATTCAATCATATGG + Intergenic
993608849 5:90030169-90030191 AAATATTTACTTCAATGATATGG + Intergenic
994708205 5:103231879-103231901 TTATAAGGACATCAGTCATATGG - Intergenic
995086988 5:108122500-108122522 AAATATGGACTTATGTTTTATGG + Intronic
996695240 5:126387138-126387160 AAATATGGACTTCAGTCATATGG - Intronic
997825799 5:137106062-137106084 CTTTATGGACTTCAGTCATCTGG - Intronic
998723281 5:144977849-144977871 ACATATGGCCCTCAGTAATATGG + Intergenic
998948666 5:147368750-147368772 AAAAATTAAATTCAGTCATATGG + Intronic
1001168189 5:169390929-169390951 AAATAGGGACTTCAATGATTTGG + Intergenic
1003475826 6:6481824-6481846 GAAGAAGGGCTTCAGTCATATGG + Intergenic
1003936473 6:10979662-10979684 AAACATGACTTTCAGTCATAGGG - Intergenic
1008976715 6:57435541-57435563 AAGTATGGACTTCTGAAATATGG + Intronic
1009864591 6:69381042-69381064 AAATATGGATTTGTGTCATAAGG - Intronic
1011000781 6:82585904-82585926 AAATATTGACTTTACTAATAAGG + Intergenic
1011706313 6:90004645-90004667 AACTATGAAGTTCAGTCTTATGG - Intronic
1011820508 6:91247742-91247764 CAATAAGGTCATCAGTCATATGG + Intergenic
1012134052 6:95533720-95533742 AAATAAGGACTTCAGTAGCAAGG - Intergenic
1014370355 6:120599168-120599190 AAAAATGGAGTTCAGCCATTCGG + Intergenic
1014732992 6:125056439-125056461 AAAAATGGTATTCTGTCATAAGG - Intronic
1014948694 6:127528551-127528573 AGATATGTACTTCAGTCTCAAGG + Intronic
1015275795 6:131382261-131382283 AAATACAGACTACAGACATAAGG + Intergenic
1017095624 6:150802428-150802450 TAAGATGGCCTTCAGTCAAAAGG + Intronic
1017268559 6:152479391-152479413 AAGTAAGGCTTTCAGTCATAAGG - Intronic
1020520395 7:9178637-9178659 AAATCTGAACTTCACTCAGAGGG + Intergenic
1020868695 7:13600000-13600022 AAATAAGGTCTTCAGACATGGGG + Intergenic
1020986984 7:15148178-15148200 AAATATGTACTTTAGGCAGAAGG - Intergenic
1022354347 7:29598341-29598363 AAATATGGACTCCATGAATAAGG + Intergenic
1024091442 7:45945221-45945243 AAGTATGTACTTCAGGCAGAAGG - Intergenic
1028319189 7:89438540-89438562 ACATGTGGCCTTCAGTCATCCGG - Intergenic
1028573313 7:92316747-92316769 GAATGTGGACTTCATTCATTGGG - Intronic
1028690986 7:93650369-93650391 AGATTTGGAGATCAGTCATATGG + Intronic
1032169008 7:129568678-129568700 AATTGTGTACTACAGTCATATGG + Intergenic
1034035417 7:147815385-147815407 AAATAGGAATTTCAGTCCTATGG - Intronic
1034212924 7:149380944-149380966 CAATAGGGACCTCAATCATATGG + Intergenic
1036394631 8:8358752-8358774 CAATAGGGACTTCACCCATAAGG - Intronic
1036644573 8:10603731-10603753 AAATATAAACTGCAGACATACGG + Intergenic
1036966837 8:13308206-13308228 AAATATGGACATTGGCCATAAGG - Intronic
1038360951 8:26876579-26876601 AAATCTGTACTTCAGAAATAAGG - Intergenic
1039313224 8:36342855-36342877 TTATATGGCCTTCAGTCATATGG - Intergenic
1040971898 8:53144296-53144318 GAATAGAGACATCAGTCATATGG + Intergenic
1043217795 8:77617574-77617596 AAATAGGTAGTTCAATCATATGG - Intergenic
1043931743 8:86099227-86099249 AAATCTGGACTGCAGGAATAAGG - Intronic
1046472830 8:114701099-114701121 TAATATGGACTCCATTCATGAGG + Intergenic
1047027444 8:120839453-120839475 AAATATTGACTTCTGTCCAAAGG + Intergenic
1047461892 8:125073435-125073457 ACATATGGATTACAGTTATAGGG + Intronic
1047461895 8:125073488-125073510 ACATATGGACTACAGTTATAGGG + Intronic
1047461898 8:125073555-125073577 ACATATGGACTACAGTTATAGGG + Intronic
1047952201 8:129944179-129944201 CAATATGGACTACAGTGGTAGGG + Intronic
1050706424 9:8404020-8404042 AGAGATGCACTTCTGTCATATGG + Intronic
1051115683 9:13691776-13691798 TAATATGGACTTCATTAAAATGG - Intergenic
1051304554 9:15694868-15694890 AAATCATGACTACAGTCATATGG - Intronic
1051670745 9:19507605-19507627 AAGTATGTACTTCTGTCACATGG - Exonic
1053107013 9:35418181-35418203 AAATATGGAATTAAGTAAAATGG + Intergenic
1053645420 9:40117128-40117150 CCATGTGGACTTTAGTCATAAGG - Intergenic
1053760294 9:41346399-41346421 CCATGTGGACTTTAGTCATAAGG + Intergenic
1054326440 9:63715029-63715051 CCATGTGGACTTTAGTCATAAGG - Intergenic
1054539153 9:66258844-66258866 CCATGTGGACTTTAGTCATAAGG + Intergenic
1055122549 9:72678989-72679011 AAATATAGACTTCAGTGGGATGG - Intronic
1055884351 9:81042250-81042272 AAATTTGTACTTCAGTCTTCAGG + Intergenic
1057018632 9:91678405-91678427 TTATAAGGACATCAGTCATATGG - Intronic
1057815376 9:98290374-98290396 AAATAAGGACTTCACAAATAAGG + Exonic
1062074931 9:134582317-134582339 AAATATGGTGTTCAATCATTTGG + Intergenic
1202793214 9_KI270719v1_random:100584-100606 CCATGTGGACTTTAGTCATAAGG - Intergenic
1185936287 X:4261047-4261069 AAATATGGGCTTCAGTATTTGGG - Intergenic
1186734295 X:12444922-12444944 AAATATGTACTGCAGTGCTAAGG - Intronic
1188025015 X:25199207-25199229 AGATATGGACATCACACATATGG + Intergenic
1188378148 X:29458401-29458423 AAATATGGACTACTGCCAAATGG + Intronic
1194095516 X:89634056-89634078 AAATATGGACTTCTAACATGTGG - Intergenic
1195242386 X:102965424-102965446 AAGTTTGGACTTCTGTCATGAGG - Intergenic
1196260898 X:113580170-113580192 AACTATTGATATCAGTCATATGG - Intergenic
1196770438 X:119288196-119288218 GAATATTGTCTGCAGTCATAGGG - Intergenic
1196841031 X:119859350-119859372 ATATAAGGAATTCAGTCACATGG + Intergenic
1196861484 X:120033089-120033111 AACTATGTTCTTCAGTCACATGG + Intergenic
1197679628 X:129368483-129368505 AAATATGGACTTCACCCAGTGGG - Intergenic
1199165035 X:144662271-144662293 AAAGAAGGACTTGAGTCATGGGG - Intergenic
1199396444 X:147344124-147344146 AAATGTGGACCTCATTCATGGGG + Intergenic
1200356340 X:155556190-155556212 AAACAGGGACTTCAGTCCTATGG + Intronic
1200448149 Y:3290235-3290257 AAATATGGACTTCTAACATGTGG - Intergenic