ID: 996697202

View in Genome Browser
Species Human (GRCh38)
Location 5:126410989-126411011
Sequence TCTAATATGCAGAATCTAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 12129
Summary {0: 1, 1: 54, 2: 1735, 3: 5443, 4: 4896}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996697202 Original CRISPR TCTAATATGCAGAATCTAGA AGG (reversed) Intronic
Too many off-targets to display for this crispr