ID: 996699435

View in Genome Browser
Species Human (GRCh38)
Location 5:126435471-126435493
Sequence CAGGGAGAGCAGAAGGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1837
Summary {0: 1, 1: 0, 2: 12, 3: 167, 4: 1657}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996699426_996699435 12 Left 996699426 5:126435436-126435458 CCTGTGGCGTGACTGGCTGGGGC 0: 1
1: 0
2: 1
3: 9
4: 151
Right 996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG 0: 1
1: 0
2: 12
3: 167
4: 1657

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996699435 Original CRISPR CAGGGAGAGCAGAAGGGGGA AGG Intronic
900123756 1:1060427-1060449 CAGGGAGCGCCGAGGGGGGCCGG + Intergenic
900390414 1:2431532-2431554 AGGGGAGACCAGATGGGGGAGGG + Intronic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
900766996 1:4512434-4512456 CAGAGAGAGAAAGAGGGGGAGGG + Intergenic
900832813 1:4977328-4977350 CAGGGAGTGCTGAAGGTGCAAGG - Intergenic
900897886 1:5496510-5496532 CTGGCAGAGCAGATGGGAGAGGG + Intergenic
901036417 1:6338764-6338786 CAGGGAGAGGACCAGGGGCAGGG + Intronic
901186357 1:7375869-7375891 CAGGGTGGACAGAAGGGGGCAGG + Intronic
901420325 1:9146338-9146360 CAGGAAGAGGAGGAGGAGGAAGG - Intergenic
901462948 1:9402360-9402382 CAGGCAGAGGTGTAGGGGGAAGG - Intergenic
901788232 1:11638704-11638726 GAGGGAGAGCAGGAGGGAGGAGG - Intergenic
902517166 1:16995810-16995832 CAGTGAGGGCAGGAGTGGGATGG + Intronic
902550837 1:17218761-17218783 AAGGGAGGGGAGAAGGGGCAAGG + Intronic
902663567 1:17921952-17921974 CAAGGAGAACAGAAAGGGGTGGG - Intergenic
902677770 1:18020769-18020791 GAGGGAGAGAAAAAGAGGGAGGG - Intergenic
902712556 1:18250125-18250147 AAGAGAGAGCAGGAGAGGGAGGG - Intronic
902763492 1:18599523-18599545 GAGGGAGAGAAGGAGAGGGAAGG + Intergenic
902841162 1:19074767-19074789 GAGGGAGAACAGAGGGTGGAAGG + Exonic
902865133 1:19273105-19273127 CAGGAAGAGTACAAGGGGCAAGG - Intergenic
902867224 1:19287704-19287726 CAGGAAGAGTACAAGGGGCAAGG - Intronic
902922118 1:19672275-19672297 ATGGGACAGGAGAAGGGGGAGGG - Intronic
902936613 1:19769319-19769341 CAAGGAGAGCAGAGAGAGGAGGG - Intronic
903081175 1:20814771-20814793 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
903147858 1:21387037-21387059 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
903352307 1:22725023-22725045 CACCAAGAGCAGAAGGGGGAGGG - Intronic
903670527 1:25032928-25032950 CAGGGAGACCAGAATGTGAATGG - Intergenic
904045090 1:27603940-27603962 GAGGGAGGGGAGGAGGGGGAGGG - Intronic
904077159 1:27852149-27852171 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
904208122 1:28868114-28868136 TAGGGAGGGCAGGAGGGTGATGG + Intergenic
904311200 1:29630729-29630751 AAGGAAGAGAAGAAGGGGGGGGG - Intergenic
904354576 1:29930760-29930782 CAGGGACAGCTGTAGGGAGAGGG - Intergenic
904684815 1:32252270-32252292 CAGGCAGGGCTGAAGCGGGAGGG - Intronic
904849055 1:33443486-33443508 CAGGGAGAACAGCAGGTAGAGGG + Intergenic
904911497 1:33937603-33937625 GAGGAAGAGAGGAAGGGGGAGGG - Intronic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905375020 1:37514428-37514450 CCGGGAGCGCGGGAGGGGGAGGG - Intronic
905510959 1:38519744-38519766 AAGGGAGAGGAGAAGGGAGGGGG + Intergenic
905531293 1:38681020-38681042 CATGGAGAGCAAATGGGGGGGGG - Intergenic
905816155 1:40952615-40952637 CAGCGGGAGCAGAACGGGAATGG + Intergenic
906135974 1:43501244-43501266 AAGGGAGAGGGGAGGGGGGAGGG - Intergenic
906191973 1:43904758-43904780 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192249 1:43905754-43905776 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192337 1:43906081-43906103 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906192381 1:43906225-43906247 CAGGAAGAGGAGCAGGAGGAGGG - Intronic
906261032 1:44390252-44390274 CAGGGAGAGAAGAGAGGGGTTGG + Intergenic
906685066 1:47757820-47757842 CTGGCAGAGCAGATGGGGGTGGG + Intergenic
906723053 1:48023261-48023283 CAGGCGGGGCAGAAGGGGCAGGG - Intergenic
906733758 1:48104985-48105007 CAGGGAGAAAAGGAAGGGGAGGG + Intergenic
907184030 1:52595330-52595352 CAGGGGGAGCAGATGAGGAATGG + Intergenic
907273578 1:53304725-53304747 CAGGGCCAGCAGTATGGGGATGG + Intronic
907303581 1:53502350-53502372 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303609 1:53502430-53502452 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303637 1:53502510-53502532 GGGAGAGAGGAGAAGGGGGAGGG + Intergenic
907303660 1:53502579-53502601 GAGGGAGAGAAGAGAGGGGAGGG + Intergenic
907303694 1:53502701-53502723 CAGAGAGAGGAGAGTGGGGAGGG + Intergenic
907303791 1:53502983-53503005 CAGGGAGAGAGGAGGGGGGAAGG + Intergenic
907332134 1:53678309-53678331 CTGGGAGTGCAGGAGGGTGAGGG + Intronic
907462145 1:54611499-54611521 AAGGGATATCAGAAGGGGGAAGG - Intronic
907466910 1:54644294-54644316 GAGGGAGAGCAGGGGAGGGAGGG - Intronic
907594063 1:55703665-55703687 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
907745177 1:57206225-57206247 CAGGGAGAAAAGGAGGGAGAGGG + Intronic
907855214 1:58296579-58296601 GAGGAAGAGCACAAGGGTGAAGG - Intronic
907859522 1:58338279-58338301 GAGGGAGAGCAGGAGGAGGGAGG - Intronic
907938580 1:59065269-59065291 CACGGAGACCAGGAGTGGGAGGG + Intergenic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
908162828 1:61427735-61427757 CAGGGGGAGCTAAAAGGGGAGGG + Intronic
908252276 1:62274530-62274552 GAGGGAGGGCAGGAGGGGCAGGG + Exonic
908550597 1:65205078-65205100 CAGGGAGGGGAGAGGAGGGAGGG - Intronic
908783557 1:67713479-67713501 CAGGGAGAGCAGGGTGGGGATGG + Intronic
908959956 1:69684901-69684923 CAGGGAGAGCAGAGCAGGGATGG - Intronic
908979936 1:69943450-69943472 GAGGGAGAGGAGAATGGGTATGG + Intronic
909463726 1:75948698-75948720 CAGGGAGAAGGGAATGGGGAAGG + Intergenic
909481586 1:76132753-76132775 CAGGGACAGAAGAAGGGACAAGG + Intronic
909483079 1:76146501-76146523 GAGGGAGAAAAGAAGGAGGAGGG - Intronic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
910226936 1:84945183-84945205 CAAGGAGGGCAGCAGGCGGAAGG + Intronic
910343591 1:86215096-86215118 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
910455691 1:87395186-87395208 CAGGAAAAGCAGCAGTGGGAGGG + Intergenic
910721429 1:90290569-90290591 CGGGGAGAGCAGCAGGGAGGAGG + Intergenic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911530626 1:99039398-99039420 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
911569610 1:99507582-99507604 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
911767059 1:101690237-101690259 CTGGGAGAGCAGAACAGAGAAGG + Intergenic
911803314 1:102173483-102173505 GAGGGAGAGAGGAAGGGAGAGGG - Intergenic
911958544 1:104269353-104269375 CAGGGAGAGGAGAAAGGAAAGGG - Intergenic
911968532 1:104399220-104399242 TAGGGAGAGAAGCAGGGGAATGG + Intergenic
912449520 1:109760586-109760608 CAGGCAGAGCAAGAGGAGGATGG - Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912860765 1:113211775-113211797 CAGGGAGGGGAGATGGGGGGAGG + Intergenic
913705536 1:121418571-121418593 GAGGGAGAGGGGGAGGGGGATGG + Intergenic
914000609 1:143691636-143691658 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914197926 1:145459820-145459842 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914214356 1:145611328-145611350 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914230800 1:145763890-145763912 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
914466294 1:147931721-147931743 AGGGGAGGGGAGAAGGGGGAAGG - Intronic
914477028 1:148032952-148032974 CAGCGGGAGCAGAAGGGACACGG - Intergenic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915188066 1:154124212-154124234 GAGAGAGAGCACAACGGGGATGG + Intronic
915342998 1:155186380-155186402 GAAGGAGAGCAGAGGGAGGAGGG - Intronic
915732171 1:158061416-158061438 CAGGGAGATCAAAAAGGGAAAGG + Intronic
915878797 1:159643419-159643441 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
915904059 1:159865327-159865349 CAGGGAGGGCAGCAGTGGGGAGG + Intronic
915953868 1:160207442-160207464 CAGGCAGAGCAGAGGAGGGCCGG - Intronic
916025256 1:160827950-160827972 AAGGGTGAGAAGGAGGGGGAGGG - Exonic
916076095 1:161200722-161200744 GTGGGAGACCAGAAGGGGCAGGG + Intronic
916216333 1:162398114-162398136 CAGACAGAGTAGAATGGGGATGG + Intronic
916325005 1:163546490-163546512 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
916332064 1:163628319-163628341 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
916524761 1:165598877-165598899 AAGGGAGAGGAGAAGAGGGGAGG + Intergenic
916671842 1:167029230-167029252 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
916851965 1:168712994-168713016 GAGGGAGGGGAGAAGGGGAAAGG + Intronic
917173738 1:172207561-172207583 CAGGGAGAGCAACAGGAGAAAGG + Intronic
917329601 1:173868225-173868247 GAGGAAGAGCAGAGAGGGGAGGG + Intronic
917889322 1:179419639-179419661 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
918095446 1:181330329-181330351 CAGGCAGAGAAGAAGGGGAGAGG - Intergenic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919465656 1:197919856-197919878 CAGGGAGAGCGGCAGGGGCCAGG - Intronic
919786966 1:201264314-201264336 CAAGGAGACCAGACAGGGGAGGG - Intergenic
919824211 1:201492341-201492363 CTGGGAGAACAGAAGGGCCAAGG - Intronic
919918934 1:202156815-202156837 TAGGGAGAGCAGGGGAGGGAGGG + Intronic
919959588 1:202452568-202452590 ACGGGAGAGGAGGAGGGGGAGGG + Intronic
919988821 1:202694700-202694722 AAGGAAGAGGAGAAGGAGGAGGG - Intronic
920004632 1:202823980-202824002 GAAGGAAAGCAGAAGAGGGAAGG + Intronic
920144075 1:203842597-203842619 CGGGGAGAGGGGGAGGGGGAGGG + Intronic
920347324 1:205314579-205314601 CAGGGAGAGGAAAAAGGGTATGG - Intronic
920419331 1:205820465-205820487 CAGGGAGAGGAGGGGAGGGAAGG - Intergenic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
920748012 1:208647208-208647230 GAGGGAGAGAGGGAGGGGGAAGG - Intergenic
920949444 1:210558521-210558543 TAGAGGGAGCATAAGGGGGAAGG + Intronic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
922025356 1:221743474-221743496 CAGGGAGAAGAGTAGGGGGCGGG + Intergenic
922056094 1:222043818-222043840 CAGGCTGGGCAGGAGGGGGAAGG + Intergenic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922412728 1:225391712-225391734 CAGGGAGAGGAGCAGGCTGATGG + Intronic
922567165 1:226608235-226608257 CAGGGAGGAAAGAAGGGAGAGGG + Exonic
922717752 1:227886084-227886106 CAGGAAGAGCAAAATGGGGTGGG + Intergenic
922746690 1:228048229-228048251 CTGGGAGAGCAGGAGGGAGAAGG - Intronic
922779225 1:228238117-228238139 AAAGGAGAGCAGCAGGTGGATGG - Intronic
922905740 1:229172337-229172359 CAGGTAGGGCAGAGAGGGGAGGG + Intergenic
922915371 1:229253015-229253037 CAGGGACAGCAGCCGGGGCAGGG - Intergenic
923198460 1:231689988-231690010 AAGGGAGAACATAAGAGGGAGGG + Intronic
923482496 1:234397552-234397574 GAGGGAGGGGGGAAGGGGGATGG + Intronic
923521630 1:234739428-234739450 AAGGGGCAGCAGAAGGGGCATGG - Intergenic
924290345 1:242529818-242529840 GAGGGAGAGAAGAAGAAGGAAGG - Intergenic
924546423 1:245031791-245031813 CAGGGAGGGCTGATGGGGTATGG + Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
924643756 1:245857971-245857993 CAGGGAGGACAGCAGGGAGACGG - Intronic
924920060 1:248619482-248619504 CAGGGGCTGCAGAAGAGGGAGGG + Intergenic
924928037 1:248702581-248702603 CTGGGAGAACAGAAGGGCTATGG - Intergenic
1062833630 10:622364-622386 GGGGGAGAGAAGAAGGGGGAGGG + Intronic
1062938656 10:1406204-1406226 CAAGGAGAGCAGCTGGGTGAGGG - Intronic
1063132877 10:3193686-3193708 CAGGCAGGGCAGGAGAGGGAAGG + Intergenic
1063221723 10:3975183-3975205 CAGAGAGACCAGAAGAAGGAAGG + Intergenic
1063244799 10:4206739-4206761 CGGGATGAGCAGAAGGAGGATGG - Intergenic
1063919731 10:10920795-10920817 GAGGGAGAGGGGATGGGGGAGGG + Intergenic
1064142108 10:12799195-12799217 CAAGGAGACCAAAAGCGGGAAGG - Intronic
1064186581 10:13167265-13167287 CAGGGAGGGCATTAGGGGCAGGG + Intronic
1064205378 10:13319593-13319615 CTGGGAAAGCTGAAGTGGGAGGG - Intronic
1064272682 10:13879723-13879745 AAGGGAGAGGAGGAGGGAGAAGG - Intronic
1064316588 10:14263316-14263338 CAGCCAGCGCAGGAGGGGGAAGG + Intronic
1064526321 10:16260412-16260434 GAGGGAGAGAGGGAGGGGGAAGG + Intergenic
1064815800 10:19260551-19260573 CAGGGAGCTCAGCAGGGGTAGGG + Intronic
1065047007 10:21753970-21753992 GTGGGAGAGGAGAAGGGGCACGG + Intergenic
1065307835 10:24385097-24385119 CAGGCAGCACAGAAAGGGGAGGG + Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065522906 10:26589173-26589195 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065528830 10:26648444-26648466 CAGGGAAAGAAGAAGGGGTGAGG - Intergenic
1065559275 10:26946059-26946081 CAGGGAAAGAAGAAGGGGTGGGG + Intergenic
1065728772 10:28691716-28691738 GAGGGAGTGGAGAGGGGGGATGG - Intergenic
1066115406 10:32234280-32234302 GAGGGAGAGGGGGAGGGGGAAGG + Intergenic
1066190010 10:33047486-33047508 AAGGGAGAGAAGAGGGTGGATGG + Intergenic
1066615468 10:37289057-37289079 CAGGGTGAGCAGAAGCAGGATGG - Intronic
1066705259 10:38170897-38170919 GAGGGAGAAAAGAAGGAGGAAGG - Intergenic
1066745911 10:38604199-38604221 CAGGGAGGGCTGGAGGGTGATGG - Intergenic
1067016938 10:42764249-42764271 AAGAGAGAGCAAAAGGGGGGAGG + Intergenic
1067044026 10:42974560-42974582 CAGGCAGGGCAGCAGTGGGAGGG + Intergenic
1067230199 10:44400986-44401008 CAAGGAGAGAGAAAGGGGGAGGG - Intergenic
1067412903 10:46080091-46080113 CAGGGAGGGCTGAAGGGATATGG - Intergenic
1067432835 10:46255171-46255193 CAAGGAAAGCAGATGGGGGCAGG + Intergenic
1067462231 10:46466306-46466328 GAGGGAGAGAGGGAGGGGGAGGG - Intergenic
1067502742 10:46820517-46820539 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1067591848 10:47519496-47519518 AAGAGAGAGGGGAAGGGGGAAGG - Intronic
1067624966 10:47918331-47918353 GAGGGAGAGAGGGAGGGGGAGGG + Intergenic
1067638963 10:48027569-48027591 AAGAGAGAGGGGAAGGGGGAAGG - Intergenic
1067672203 10:48333666-48333688 CAGGGAAAGAAGAAGGGGTGGGG + Intronic
1068174002 10:53433469-53433491 AAGGGAAAGAAGAAGGAGGAAGG + Intergenic
1068329683 10:55546868-55546890 CAGGGAAAGATGAAGGGGAAAGG + Intronic
1068453612 10:57226407-57226429 CAGGAAGAGCAGAAGTAGGGAGG + Intergenic
1068687007 10:59881011-59881033 AAGGGAGTGCAGCAGGGGGTCGG - Intronic
1069275676 10:66587848-66587870 CAGGTAGACCAGAAGGGGTGCGG - Intronic
1069385921 10:67883641-67883663 CAGGGAGAGAGGAAAGTGGAAGG + Intergenic
1069513222 10:69057437-69057459 CAGGGAGACAATAAGGGGAAGGG - Intergenic
1069657160 10:70098379-70098401 GAGGGAGGGAAGGAGGGGGAGGG + Intronic
1069755104 10:70769734-70769756 CAGGGAGAGAAGCAGGGGAAAGG + Intergenic
1069859359 10:71460856-71460878 CAGGAAGAGCAGAAGTGAGTGGG + Intronic
1069891808 10:71656793-71656815 CACAGAGAGCAGGAGGGGCATGG + Intronic
1070362377 10:75703254-75703276 CAGGAAGGGAAGAAGGGAGAAGG + Intronic
1070463226 10:76690951-76690973 CATGGGGAGGAGGAGGGGGAGGG - Intergenic
1070603182 10:77879799-77879821 CAGGAAAAACAGATGGGGGAGGG + Intronic
1070731266 10:78830150-78830172 TAGAGAGGGCAGAAGGGGAATGG - Intergenic
1070769433 10:79073698-79073720 TGGGGGGTGCAGAAGGGGGAAGG + Intronic
1071268973 10:83989794-83989816 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071268981 10:83989835-83989857 AAGGGAGGGAAGAAGGAGGAAGG + Intergenic
1071456575 10:85855889-85855911 CAAGGAGAGAGGAATGGGGAGGG + Intronic
1071508308 10:86246080-86246102 CTGGGAGAGCAGAGCTGGGAAGG - Intronic
1071587746 10:86841791-86841813 TAGGGAGGGGAGAAGGGCGAAGG + Intronic
1071616275 10:87079904-87079926 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1071796896 10:89017723-89017745 CAGCGAGGGCAGAAGGAGGAAGG - Intergenic
1072195743 10:93116045-93116067 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1072404324 10:95136032-95136054 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
1073152744 10:101323008-101323030 CAGGGAGAGGAGCAGGAGGAGGG + Intergenic
1073433015 10:103499139-103499161 CAGCCAGAGCTGGAGGGGGACGG - Intronic
1073436286 10:103518321-103518343 AAGGGAGAGGAAGAGGGGGAAGG - Intronic
1073592143 10:104767660-104767682 AAGGGAGTGGAGAAGGGGAAGGG - Intronic
1073597715 10:104817394-104817416 AAGGGGGAGGAGGAGGGGGAAGG - Intronic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1073935546 10:108626935-108626957 GAGGGAGAGCAGGAGCGAGAAGG - Intergenic
1074386262 10:113018984-113019006 CAGAGGGAGCACAAGAGGGAGGG + Intronic
1074405662 10:113178385-113178407 GAGGGAGAGAAGGAGGGAGATGG + Intergenic
1074412040 10:113236633-113236655 CAGGTACACCAGAAAGGGGAGGG + Intergenic
1074467045 10:113692511-113692533 CAGGCAGACCAGAAGGGGCGTGG - Intronic
1074626074 10:115188035-115188057 CTGGGAGAGAGGGAGGGGGAGGG + Intronic
1074757469 10:116635119-116635141 CAGGGTGGGCTGGAGGGGGAAGG + Intronic
1074863117 10:117528161-117528183 CAGGGAGGGCTGATGGGGTAAGG - Intergenic
1074898435 10:117796433-117796455 GAGAGAAAGCAGAAGGGGCAGGG - Intergenic
1075042986 10:119123390-119123412 CAGGAAGAGGAGAAGGGGGCAGG + Intronic
1075065836 10:119288299-119288321 CAGGGGGAGGAGAAAGTGGAGGG + Intronic
1075108741 10:119560524-119560546 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1075137382 10:119796072-119796094 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1075284483 10:121171785-121171807 AAGGGAAGGCAGAAGGGGAAGGG + Intergenic
1075407473 10:122204177-122204199 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1075450613 10:122549524-122549546 GAGGGAGAGGAGAAGGGGACAGG + Intergenic
1075602355 10:123779340-123779362 TACCGAGTGCAGAAGGGGGAAGG - Intronic
1075663503 10:124214676-124214698 CAGGCAGAGCAGGAAGAGGAGGG + Intergenic
1075842610 10:125517745-125517767 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1075940666 10:126388092-126388114 CAGGGCGAGCAGGAGGGCGCGGG + Exonic
1076070228 10:127482962-127482984 CAGGGAGTGGACAAGGGGGAAGG - Intergenic
1076122593 10:127948132-127948154 CCAGGAGAGCAGATGGGGAAGGG + Intronic
1076312529 10:129518543-129518565 AAGGGAGGGGAGGAGGGGGAGGG - Intronic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076480573 10:130782662-130782684 CAGAGAGACCAGCAGGGGGAGGG + Intergenic
1076517746 10:131058119-131058141 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1076560364 10:131359125-131359147 CAGGAAGAGCAGTGTGGGGAGGG - Intergenic
1076633050 10:131863578-131863600 CTGGGAGAGCCGAAGGGAGAAGG + Intergenic
1076749515 10:132535598-132535620 CAGGGAGGGCACAAGGGGTGGGG + Intergenic
1076790669 10:132775178-132775200 CAGGGAGAGAGGGAGGGGCAGGG + Intronic
1076790687 10:132775212-132775234 CAGGGGGAGGGGCAGGGGGAGGG + Intronic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076846336 10:133071300-133071322 GAGGGAGAGCAGGAGGGACAGGG - Intronic
1076856024 10:133116000-133116022 GAGGGAGAGGGGAATGGGGAGGG - Intronic
1076891081 10:133283729-133283751 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076891089 10:133283766-133283788 CAGGGAGTGCAGGAGAGGCAGGG - Intronic
1076988162 11:254153-254175 CAGGGAGAGCAGATGAGGGTAGG - Intergenic
1077009718 11:374684-374706 CAGGGAGGGAGGGAGGGGGAAGG + Intronic
1077046990 11:551105-551127 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
1077299452 11:1840328-1840350 CAGGGAGCGTGGAAGGGGGTGGG + Intronic
1077394173 11:2313069-2313091 CAGGGGGTGAAGAAGGTGGAAGG - Intronic
1077889800 11:6410884-6410906 GAGGGAGAGGAGAAGGCGGCCGG - Exonic
1077902749 11:6502941-6502963 CAGGGGGAGGAGAAGGGGCCTGG - Intronic
1078032163 11:7763926-7763948 AAAGCAGGGCAGAAGGGGGAAGG + Intergenic
1078062884 11:8059862-8059884 CAAGGAGACCAGAAGGAGGCTGG + Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078546337 11:12249672-12249694 CAGTGAGAGCAGAATGTGCAGGG - Intronic
1078578760 11:12522964-12522986 GAGGGAATGTAGAAGGGGGAGGG + Intronic
1078950027 11:16120156-16120178 GAGAGAGAGCAGGAGGGGGAGGG - Intronic
1079524213 11:21364812-21364834 CAGGGAGATGAGAAGGTGAAGGG + Intronic
1080394208 11:31875063-31875085 CAGGAGCAGCAGGAGGGGGAAGG - Intronic
1080405155 11:31972048-31972070 GAGGGGGAGCGGGAGGGGGAGGG + Intronic
1080538196 11:33243016-33243038 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1080895835 11:36448273-36448295 CATGGAGAGCAAATGGGGGTGGG - Intronic
1081085645 11:38796913-38796935 CAATCAGAGCAGAAGGGGAAAGG - Intergenic
1081279205 11:41187509-41187531 TGGGGAGGCCAGAAGGGGGATGG - Intronic
1081623983 11:44635690-44635712 CAGGGAGATCAGAAGGCAGCAGG + Intergenic
1081659487 11:44879267-44879289 TAGGGAAAGAAGAAGGAGGAAGG - Intronic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1082132438 11:48506529-48506551 AAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1082239707 11:49857085-49857107 CAGGGAGAGAAGAAGACAGAGGG - Intergenic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082669795 11:56020878-56020900 GAGGAAGAGCAGGAGGAGGAGGG + Intergenic
1082812880 11:57489221-57489243 CAGGGAGAGGGGAAGGATGAAGG + Intronic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082892430 11:58154195-58154217 AAGGGGGAGGAGAAGGAGGAAGG + Intronic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083130522 11:60621353-60621375 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1083141844 11:60728696-60728718 GAGGGAAAGGAAAAGGGGGAAGG - Intergenic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083322856 11:61857820-61857842 CAGGGAGCGGGGAAGGGAGATGG - Intronic
1083382097 11:62277872-62277894 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1083386456 11:62313802-62313824 CAGAGAGAGAAGCAGGGGCAGGG + Intergenic
1083388800 11:62333198-62333220 CAGCGAGGCCAGAAGGGGGATGG + Intergenic
1083553728 11:63609644-63609666 CAGAGAGAGAAGGAGGAGGAGGG + Intronic
1083613601 11:64015809-64015831 GAGGGGGCGCAGAAGGGGGCAGG + Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1083990820 11:66244666-66244688 CAGAGAGAGGAGATGGGGGTGGG + Exonic
1084128994 11:67119167-67119189 CAGGGAGGCCTGAAGGGGGTGGG + Intergenic
1084308100 11:68299557-68299579 GAGGAAGAGCTGAAGGGGAAGGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084476082 11:69390565-69390587 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
1084519956 11:69657051-69657073 CAGGGAGAGCTGACTGCGGAAGG - Intronic
1084557897 11:69885727-69885749 GGGGGAGGGCAGAAGGGGGAGGG + Intergenic
1084793368 11:71489051-71489073 CAGAGAGAGCAGGAGGGGAGGGG + Intronic
1084794026 11:71492132-71492154 GAGGGAGAGCAGATGGCGGGCGG + Intronic
1085097618 11:73774368-73774390 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1085112240 11:73898200-73898222 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1085186392 11:74579411-74579433 CAGGGACAGCAGAGGGGTGGTGG + Intronic
1085263996 11:75225587-75225609 CAGAGAGAGCAGGAGGGGAGTGG - Intergenic
1085329227 11:75633829-75633851 AAGGGCGAGCAGAGTGGGGAGGG + Intronic
1085502707 11:77038083-77038105 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1085643918 11:78210338-78210360 CAGGCGGAGCAGCAGGGGGATGG - Exonic
1085778846 11:79390343-79390365 GAAGAAGAGCAGAAGGGGAAGGG - Intronic
1085893830 11:80612930-80612952 GAGAGAGAGCAGGAGAGGGAAGG + Intergenic
1086084120 11:82937718-82937740 CATGGCCTGCAGAAGGGGGAAGG + Intronic
1086605909 11:88696114-88696136 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1086926747 11:92648940-92648962 AAGGGAGAGCAGAAGGAGAGGGG - Intronic
1086931172 11:92694724-92694746 CCGGAAGAGCAGCAGGGTGAAGG + Intronic
1087006722 11:93478958-93478980 CAGGGAGAGGAGGCGCGGGAGGG - Exonic
1087214568 11:95481783-95481805 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1087275372 11:96155717-96155739 CAAGGAGAGCAGGAGGGGCGGGG - Intronic
1087512414 11:99114444-99114466 GAAGGAAAGAAGAAGGGGGATGG - Intronic
1087583989 11:100094734-100094756 CAGGGAAAGAAGAAGGAGGGAGG + Intronic
1087642456 11:100769825-100769847 CAGGGGGAGGTGTAGGGGGATGG + Intronic
1088051161 11:105517324-105517346 GAGAGAGAGCAAAAGGGAGAGGG + Intergenic
1088051175 11:105517354-105517376 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
1088182323 11:107126841-107126863 GCAGGAGATCAGAAGGGGGAAGG - Intergenic
1088489801 11:110375871-110375893 TAGGGAGAGTAGAAGAGAGAGGG - Intergenic
1088559582 11:111099099-111099121 CAGGAAGAGGAGGCGGGGGAGGG + Intergenic
1088691564 11:112333007-112333029 CTGGGGGAGCAGTAGGAGGAAGG - Intergenic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1088871576 11:113894654-113894676 GAGGGAGTGCAGAAGAGGAACGG - Intergenic
1088907745 11:114167647-114167669 CTGGGAGAGCAGGAGGGGGCTGG - Intronic
1089100403 11:115958195-115958217 TAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1089175766 11:116547836-116547858 CAGGGAGAGAGGGAGGGGGTGGG - Intergenic
1089217666 11:116845076-116845098 AAGGGAGAGAGGAAGGGTGACGG - Intronic
1089355101 11:117844431-117844453 CTGGGAGAGAGGCAGGGGGATGG - Intronic
1089632433 11:119792056-119792078 CAGGGAGGGCAGAGTGGGGCTGG + Intergenic
1089634838 11:119805431-119805453 CAGGGACAGTTGATGGGGGAAGG - Intergenic
1089873491 11:121697346-121697368 CTGGCAGAGCAGAGGGGAGAGGG - Intergenic
1089959089 11:122599835-122599857 CAGGGAAAGCAGAATGAGGAAGG - Intergenic
1089969580 11:122682013-122682035 CAGGGAGAACAGACAGGAGATGG - Intronic
1090095877 11:123741455-123741477 CAGGGCGGGGAGGAGGGGGAGGG - Intronic
1090238721 11:125166981-125167003 CAGAGAGAGCAGGAGGGCAAGGG - Intronic
1090319883 11:125833065-125833087 CAGGGAAGGCAGAGGGAGGATGG + Intergenic
1090350723 11:126106075-126106097 CATGGAGAACAGCAGAGGGAGGG - Intergenic
1090410349 11:126503781-126503803 CAGAGAGAGAAGGAGAGGGAGGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1090497708 11:127230778-127230800 GGGGGAGAGGAGATGGGGGATGG + Intergenic
1090575322 11:128095826-128095848 CATGGAGAGCACAAGGTGGCTGG - Intergenic
1090703229 11:129314795-129314817 GAGGGAGAGGGGAAGGGGGAAGG - Intergenic
1090941217 11:131389900-131389922 AAAGGAGACCAGAAGGGTGAGGG + Intronic
1091548155 12:1518361-1518383 GAGGGACAGCAGAAAGGGGGTGG + Intergenic
1091590835 12:1842202-1842224 CGTGGAGTGCAGAAGGGGGCGGG + Intronic
1091635624 12:2194372-2194394 GAGGGGGAGCAGGAAGGGGAAGG - Intronic
1091690983 12:2597298-2597320 CAGGAGGAGCAGAAGGGGATGGG - Intronic
1091726312 12:2848918-2848940 TAAGGAGAGGAGAAGTGGGAAGG - Intronic
1091797155 12:3304013-3304035 CAGGGAGAGCAAAGAGGGGTTGG - Intergenic
1091857915 12:3753810-3753832 CAGGCAGAGATGAAAGGGGAGGG - Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1091936591 12:4439827-4439849 GAGAGAGAGCAGCAAGGGGAAGG - Intronic
1092060736 12:5548331-5548353 CAGGCAAAGCAGCAGGGGGTTGG + Intronic
1092091713 12:5809129-5809151 GAGGGAGTGCAGATGGGGGAAGG + Intronic
1092239484 12:6828371-6828393 GAGGGAGAGGAAAGGGGGGAAGG - Intronic
1092453353 12:8624325-8624347 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1092758811 12:11790559-11790581 CAGTGGGAGAAGAAGGGGTAGGG + Intronic
1093100330 12:15020567-15020589 CAGGGAGTTAATAAGGGGGATGG + Intergenic
1093141304 12:15513246-15513268 GAGGGAGAGAGGGAGGGGGAAGG + Intronic
1093243134 12:16702094-16702116 CTGGGACAGCAGGAGGGAGAGGG + Intergenic
1093534816 12:20210275-20210297 AGGGGAGAGGGGAAGGGGGAAGG - Intergenic
1093957406 12:25236634-25236656 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1094083798 12:26566327-26566349 GAGGGAGAGGAGAAGGAGAAGGG + Intronic
1094166167 12:27446261-27446283 CAGAGGGAGCAGGAGGGGAAGGG + Intergenic
1094209227 12:27873298-27873320 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1094818304 12:34206689-34206711 CAGAAAGAGCACAAGGTGGAAGG - Intergenic
1094855552 12:34401260-34401282 CAGGAAGAGTTGAAAGGGGAGGG + Intergenic
1095381288 12:41596268-41596290 CAGAGAGGGCACAATGGGGATGG + Intergenic
1095774699 12:45999599-45999621 GAGGGAGAGGAAGAGGGGGAGGG - Intergenic
1096116894 12:49060249-49060271 CGGGGGGAGCAGAAGGTGGGGGG - Intergenic
1096583369 12:52602648-52602670 CTGGGGGAGCAGAGGAGGGAAGG - Intergenic
1096665174 12:53159772-53159794 CAGGGAGAGGGGAAAGGGGCAGG - Intronic
1096694040 12:53337624-53337646 CTGGGAGAGCAAAAGGAGCAAGG - Intronic
1096863814 12:54549533-54549555 GAGGGAGAGCAGAGGGAGGGGGG + Exonic
1096968215 12:55645652-55645674 AAGGAAGAGAAGAATGGGGAAGG - Intergenic
1097008130 12:55933347-55933369 CAGGGAAACCAGAGGAGGGAAGG + Intronic
1097028722 12:56076739-56076761 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1097194059 12:57234164-57234186 CAGTGAGATCAGCTGGGGGAGGG - Intronic
1098305596 12:69099467-69099489 GAGGCAGAGAAGAAGGGGGCGGG + Intergenic
1098706933 12:73702835-73702857 TAGGTAGAGCACCAGGGGGAAGG + Intergenic
1098772765 12:74575404-74575426 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1099406392 12:82268620-82268642 TAGGGAGAGTAGTAGGGGGAAGG + Intronic
1099959182 12:89380414-89380436 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1100164389 12:91900174-91900196 GAGAGAGAGCAAAAGGGGAATGG - Intergenic
1100206718 12:92357792-92357814 CAGAGAGAGGAGCAGAGGGAGGG - Intergenic
1100263054 12:92950649-92950671 GAGGGAGAGAAGAGGGAGGAAGG + Intergenic
1100550742 12:95644399-95644421 AAGGGGGAGAAGAAGGGGGAAGG - Intergenic
1100793094 12:98152151-98152173 GAGGGAGGGAAGGAGGGGGAAGG + Intergenic
1101348144 12:103905220-103905242 AAGAGAGAGGAGGAGGGGGATGG + Intergenic
1101359685 12:104014582-104014604 CAGGGAGAGGAGAAAGAGGGTGG + Intronic
1101505694 12:105344355-105344377 CAGGGATGGCAGAACGGTGATGG - Intronic
1101785977 12:107884011-107884033 CAGGGATAACGGAAGGAGGAAGG - Intergenic
1101885009 12:108655362-108655384 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1101909457 12:108850632-108850654 CAGGGAGGGGAGATGGGAGAGGG + Intronic
1102175195 12:110868743-110868765 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1102230406 12:111257776-111257798 CAGGAAGAGGAGGAGGAGGATGG - Intronic
1102454076 12:113060802-113060824 CTGTGAGAGCAGAAGTGGGTAGG + Intronic
1102650779 12:114440872-114440894 CACGGAAAGCAGAAGGCGGAAGG + Intergenic
1102678800 12:114676243-114676265 CTGGAAGAGTTGAAGGGGGATGG - Intronic
1102808101 12:115799714-115799736 GAGGAAGAGGAGGAGGGGGAGGG + Intergenic
1102866920 12:116382030-116382052 CAAGGAATGCAGAAGGGGGGTGG - Intergenic
1103013899 12:117479311-117479333 CTGGGAGTGCAGGAGGTGGATGG - Intronic
1103025204 12:117568175-117568197 GAGGGAGAGGAGAGGAGGGAGGG - Intronic
1103883347 12:124183214-124183236 CAGGGAGAGAACAAGCTGGAAGG - Intronic
1104627087 12:130366375-130366397 GAGGGAGGGCAGAAGGGCCAGGG + Intronic
1104634221 12:130427595-130427617 CTGCCAGAGCAGAAGGGAGAGGG + Intronic
1104649708 12:130522706-130522728 CAGGGAGAGGAGGAGGAGGTGGG + Intronic
1104938021 12:132376959-132376981 CAGAGAGAGAGGAAGGGAGACGG + Intergenic
1104956021 12:132466204-132466226 GAGGAAGAGGAGGAGGGGGACGG - Intergenic
1105591501 13:21796830-21796852 CAGGGAGAGGAGAAGAAGGCAGG - Intergenic
1105614335 13:21998712-21998734 CAGGGAGCTCAGAGGGTGGAGGG + Intergenic
1105898483 13:24738375-24738397 CAGGGAGAACAGAAGGGGCCTGG - Intergenic
1105947642 13:25203132-25203154 GAGGGATGGCAGAATGGGGAGGG + Intergenic
1106023409 13:25935626-25935648 AAGGGAGAGAACAAGGGGTAGGG + Intronic
1106068482 13:26382087-26382109 AAGGAAGAGCAGAAGGAGTAAGG - Intronic
1106378893 13:29216655-29216677 CAGGGTGAGCAGAAGCAGGGTGG - Intronic
1106560388 13:30840591-30840613 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1106650785 13:31688075-31688097 GAGGGTGAGCAGAAGAGGGTGGG + Intergenic
1106679956 13:31999445-31999467 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1107014544 13:35697554-35697576 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1107042677 13:35966500-35966522 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1107473538 13:40713148-40713170 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1108496700 13:51032664-51032686 CAGAGAGAAAAGAAAGGGGAAGG + Intergenic
1108498455 13:51046870-51046892 GATGGAGAGCAGATCGGGGAAGG + Intergenic
1108530155 13:51320944-51320966 CAGGGACAGCACATGGGGGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1110143986 13:72167336-72167358 CTGGGAGTGCAGCAGCGGGAGGG + Intergenic
1110255928 13:73433957-73433979 GAGGGGGAGGAGAAGAGGGAGGG + Intergenic
1110324549 13:74199015-74199037 CAGTGAGAGCCGAGGTGGGATGG + Intergenic
1110345645 13:74444545-74444567 CAAGGAGAGCTGAAGGTGGCAGG + Intergenic
1110860695 13:80341810-80341832 CGGGGGGAGAAGAAGGGGGAGGG + Intergenic
1110867996 13:80419911-80419933 GAGAGAGAGAAGAAGGGAGAAGG - Intergenic
1110968689 13:81733369-81733391 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1111230792 13:85341535-85341557 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1111319185 13:86603067-86603089 TATGGAGAGAAGAAGAGGGAGGG - Intergenic
1111584583 13:90268298-90268320 TGGGGAGGCCAGAAGGGGGATGG + Intergenic
1111622851 13:90746719-90746741 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
1112419857 13:99238469-99238491 GAGGGCGAGCAGGAGGGAGAGGG - Exonic
1112508121 13:99987724-99987746 CTGGGAGAGCTGGAGGGGGGAGG - Intergenic
1112970276 13:105253218-105253240 CTGGGAGAGCAGAGGAGTGAGGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113222699 13:108123238-108123260 GAGGGAGAGCAGATGGAGGAAGG + Intergenic
1113429732 13:110239717-110239739 CAGGAAGTGCAGAAGGTAGAAGG + Intronic
1113662391 13:112116597-112116619 CGGGGAGAGCTGTAGAGGGACGG + Intergenic
1113745085 13:112738716-112738738 CTGGGGGAGGAGGAGGGGGACGG - Intronic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1113909751 13:113836404-113836426 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1113909758 13:113836422-113836444 GAGGGGGAGGAGAATGGGGAAGG + Intronic
1113975512 13:114225263-114225285 GAGGGAGAGAAGAAGGGAGAAGG + Intergenic
1114265703 14:21071406-21071428 CAGGGAGTGGAGGAGGGGCAGGG + Intronic
1114397764 14:22382505-22382527 CAGGGAGAGGAGTAGGCTGATGG + Intergenic
1114871791 14:26667155-26667177 TAGGAAGACCAGAAGGAGGAAGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115259647 14:31438216-31438238 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115771310 14:36666162-36666184 CTGGGAGAGCAAAGGGGCGAAGG + Intronic
1116040890 14:39685362-39685384 CATGGAGAACTGATGGGGGATGG - Intergenic
1116056208 14:39866657-39866679 GAGGGAGAGCAGGAGGAAGAAGG + Intergenic
1116501940 14:45634477-45634499 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117010808 14:51468315-51468337 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1117104184 14:52381982-52382004 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1117230115 14:53708245-53708267 CAAGGAGAGCCGCAGGTGGAGGG + Intergenic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1117595846 14:57326449-57326471 CAGGGAGAGGAAAAAGGGGAAGG - Intergenic
1118459559 14:65976053-65976075 GGGGAAGAGGAGAAGGGGGAAGG + Intronic
1118517914 14:66546791-66546813 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118854360 14:69610080-69610102 CAGGGAGGGGACAAGGGGGAAGG - Intergenic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1118900398 14:69981063-69981085 AAGGCAGAGCAGAAGGAGGCTGG + Intronic
1119615828 14:76098709-76098731 GAGGGAGAGAGAAAGGGGGAGGG - Intergenic
1119722204 14:76898885-76898907 CAGGGAGAGGGAGAGGGGGAGGG + Intergenic
1119722208 14:76898891-76898913 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1119859099 14:77923870-77923892 CAGGGAGGGGAGCAGGGAGAGGG + Intronic
1119886565 14:78148490-78148512 CTGGGAGAGCAGAAGCGAGAAGG + Intergenic
1119924411 14:78479189-78479211 TTGGGAGAGCAGGTGGGGGAAGG - Intronic
1120016554 14:79480740-79480762 CAAGGACAGCACTAGGGGGACGG - Intronic
1120046245 14:79810022-79810044 TAGGGATAGCAGCAGGGGTAAGG - Intronic
1120280463 14:82431747-82431769 ATGGGAAGGCAGAAGGGGGATGG + Intergenic
1120388129 14:83871237-83871259 AAGGGGGAGAAGAAGGAGGAAGG + Intergenic
1120409116 14:84129255-84129277 CAGGGAGGGCTGCAGGGAGAAGG + Intergenic
1120587004 14:86324503-86324525 CAAGGAGAGAAGAATGGGAATGG + Intergenic
1120674784 14:87408352-87408374 GAGGGAGAGAAGAGGTGGGAGGG + Intergenic
1120957255 14:90093631-90093653 CATGGAGAGCAGATGGTGGTTGG + Intronic
1120989209 14:90360371-90360393 AAGGGAGAGTAGAAGGGAGGAGG + Intergenic
1120993585 14:90398221-90398243 CTGGGGGAGCAGAAGCGGGTGGG + Intronic
1121091783 14:91187986-91188008 CAGGGAAAACATAAGAGGGAAGG - Intronic
1121254048 14:92518626-92518648 CAGGGAGAAAGGATGGGGGAAGG + Intronic
1121309966 14:92930368-92930390 CATGGAGAGCAGAAGCGCCACGG - Intronic
1121592393 14:95125746-95125768 CAGGGAGGGGAGGAGGGGGAGGG + Intronic
1121697951 14:95928302-95928324 CAGGGAGAGAGGGAGGGAGAGGG - Intergenic
1121910172 14:97782825-97782847 AGGGGAGAGAAGGAGGGGGAAGG + Intergenic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1122230635 14:100304977-100304999 CAGCGAGATCAGAAGCGGGAGGG + Intronic
1122266325 14:100548598-100548620 CAGGGTGCCCAGAAGGGGCAGGG - Intronic
1122277845 14:100604330-100604352 CTGGGAGAGCAGATTGGGGAAGG + Intergenic
1122284822 14:100644560-100644582 CAGGGAGAGCACAAGAGGCTTGG + Intergenic
1122439268 14:101718924-101718946 AAGGGAGGGGAGGAGGGGGAGGG + Intergenic
1122647907 14:103207316-103207338 CAGGGAGGGGAGAGGAGGGAGGG - Intergenic
1122652398 14:103232709-103232731 CAGTGGGAGCAGCAGGGGGATGG + Intergenic
1122658458 14:103278939-103278961 CAGGGAGAGCAGGAGGGCGCGGG + Intergenic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1122782624 14:104150110-104150132 GAGGGGGACCAGGAGGGGGAGGG - Intronic
1123871471 15:24578974-24578996 CAGGGCATGCAGAAGGGGCATGG + Intergenic
1123989980 15:25675975-25675997 GAGGGAGAGGAGGAGGGGAAAGG + Intergenic
1124045803 15:26148815-26148837 CATGGGAAGCAGAAGAGGGAAGG - Intergenic
1124159646 15:27256502-27256524 CGGGGAGAAGAGAAGGGGGCTGG + Intronic
1124245631 15:28069422-28069444 CGGGGAGAGGGGGAGGGGGAGGG - Intronic
1124641719 15:31400140-31400162 GAGGGAGAGCAGAGTGGGGGTGG - Intronic
1125037962 15:35149065-35149087 AAGGGAGGAGAGAAGGGGGATGG - Intergenic
1125397107 15:39261032-39261054 AGAGGAGAGAAGAAGGGGGAGGG + Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125697496 15:41651654-41651676 AATGGGGAGGAGAAGGGGGAAGG - Intronic
1125778598 15:42242527-42242549 CAGGGAGAGAGGGAGAGGGAGGG + Intronic
1125891068 15:43267629-43267651 GAGAGAGGGCAGGAGGGGGAAGG + Intergenic
1125892186 15:43274979-43275001 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1126385634 15:48090599-48090621 GAGGGAGAGAAGAAGGGGCAGGG + Intergenic
1126652835 15:50943034-50943056 CAGGGAGGGCAGGAGGGGAAAGG - Intronic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1127044160 15:55008540-55008562 AGGGGAGAGCAGAGGAGGGAAGG - Intergenic
1127165647 15:56243369-56243391 GGGGGAGAGGAGGAGGGGGAGGG + Intergenic
1127601746 15:60544450-60544472 CAGGGAGAGCACGAGGGGTTCGG - Intronic
1127613792 15:60663061-60663083 CAGGGAGATCAGAGTGGGGGTGG - Intronic
1127783166 15:62333347-62333369 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1127784392 15:62343117-62343139 CTGGGGGAGCACAAGGGAGAAGG + Intergenic
1127824531 15:62691038-62691060 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1127958067 15:63870561-63870583 GAGGGGGAGCAGGAGGGGGTTGG - Intergenic
1128016953 15:64356100-64356122 GAGGGAGGGGAGAAGGCGGACGG + Exonic
1128071539 15:64800058-64800080 TAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1128218923 15:65953973-65953995 CAGGGAGAGCTGGGGTGGGAGGG + Intronic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1128496419 15:68200980-68201002 CACTGAGAGCAGTAGGGTGAGGG + Intronic
1128705017 15:69832277-69832299 AAGGGAGAAGGGAAGGGGGAAGG + Intergenic
1128843893 15:70872412-70872434 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129194450 15:73955757-73955779 CTGGCAGAGAAGAAGGGGCAGGG + Intergenic
1129296278 15:74602086-74602108 CAGGGAAAGCAGCAGCAGGAGGG - Intronic
1129297719 15:74609031-74609053 CAGGGAGAGCAGATGGTGTTGGG - Intronic
1129323163 15:74785935-74785957 CTGGGAGACCGGAAGGGGAATGG - Intronic
1129324926 15:74794816-74794838 CATGGAGAGCAGAAGGAGCTGGG - Intronic
1129687038 15:77692354-77692376 CAGGAAGAGGACAAGGGGGCAGG + Intronic
1129763793 15:78148234-78148256 CAGGGAGAGGACAAGGGGAAAGG + Intronic
1129800320 15:78408954-78408976 CACAGAGACCAGAAAGGGGAAGG + Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130313922 15:82779097-82779119 GAGGGAGAGGAGAAAGGGTAAGG + Intronic
1130338491 15:82978454-82978476 CAGGTAGACCAGAGTGGGGAGGG + Intronic
1130341025 15:82999166-82999188 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1130430447 15:83842050-83842072 ATGGGAAGGCAGAAGGGGGATGG - Intronic
1130481199 15:84360682-84360704 CAGGAACGGGAGAAGGGGGATGG - Intergenic
1130838200 15:87672487-87672509 CAGGGGGAGCAGAGGATGGAAGG + Intergenic
1130908587 15:88256250-88256272 GAGGGAGGGGGGAAGGGGGAGGG + Intronic
1131017857 15:89072512-89072534 AAGGATGAGCAGGAGGGGGAGGG + Intergenic
1131126983 15:89867012-89867034 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1131449289 15:92525872-92525894 AAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1131457871 15:92597342-92597364 GAGGGAGAGCAGGAGGGAGGTGG + Intergenic
1131473266 15:92714593-92714615 AAGGGAGAGGAGGAGGGCGAGGG - Intronic
1131475119 15:92731813-92731835 CAGGGCTACTAGAAGGGGGAGGG + Intronic
1131540335 15:93270146-93270168 CAGGGAGATGAGGAGGAGGAGGG + Intergenic
1132011184 15:98277858-98277880 CAGGTAGAGCAGGAGTGGGAAGG - Intergenic
1132055356 15:98647814-98647836 CAGGGGGAGCGGAGGGGGAAGGG - Intergenic
1132574622 16:658738-658760 CAGGGAGAGCAGAAGGTGAGGGG + Intronic
1132626408 16:893735-893757 CAGGGAAAGCAGACGGGTGTGGG - Intronic
1132646645 16:1002292-1002314 CAGGGAGCCCAGAAGGGGGCTGG - Intergenic
1132647264 16:1004862-1004884 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132647310 16:1004997-1005019 GAGGGAGAAGAGAAGGGGGAGGG + Intergenic
1132647371 16:1005158-1005180 GAGGGAGAAGAGACGGGGGAGGG + Intergenic
1132674693 16:1116892-1116914 CCGGGGGAGCAGAGGGGGGCGGG - Intergenic
1132854388 16:2038413-2038435 AAGGGGGAGGGGAAGGGGGAGGG - Exonic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1132997607 16:2831306-2831328 CTGGGAGAGCACCAGGGTGAGGG + Intronic
1133278417 16:4651678-4651700 CTGGGAGAGCAGGTTGGGGATGG + Intronic
1133368318 16:5228598-5228620 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1133392053 16:5418663-5418685 GAGGGAGGAAAGAAGGGGGAAGG - Intergenic
1133392378 16:5420877-5420899 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1133443721 16:5841996-5842018 CAGGGAGAGGAGGATGAGGATGG - Intergenic
1133460748 16:5984174-5984196 GAAGGAGAGGAGGAGGGGGAGGG - Intergenic
1133485370 16:6214546-6214568 CAGGGAGAGGGGGAGAGGGAGGG + Intronic
1133568814 16:7021986-7022008 GAGGGAGAGGGGGAGGGGGAAGG - Intronic
1133771114 16:8867726-8867748 CAGGGAGTGCAGAGGGCGGTGGG + Intronic
1133786963 16:8981462-8981484 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1133839247 16:9394001-9394023 AAGGGAGACAGGAAGGGGGAGGG - Intergenic
1133839258 16:9394026-9394048 GAGGGAGGGAAGAAGGGGGATGG - Intergenic
1133842738 16:9424915-9424937 GAGGGAGAGAAGGTGGGGGAGGG + Intergenic
1134031750 16:10997682-10997704 CAGGTAGAGCAGAAAGTGAAAGG + Intronic
1134095182 16:11414294-11414316 CAGAGAGAACAGAATGTGGAGGG + Intronic
1134122817 16:11596757-11596779 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1134332618 16:13264996-13265018 CAGGAAGAGGAGAGGAGGGAAGG - Intergenic
1134357804 16:13500624-13500646 GAGGGAGAGAAGGAGGGGCAGGG + Intergenic
1134764030 16:16740100-16740122 CAGGGATAGAGGTAGGGGGAAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134770616 16:16806075-16806097 AAGGGGGAGAGGAAGGGGGAAGG - Intergenic
1134849314 16:17468121-17468143 CCAGGAGACCAGAAGGGGGCAGG - Intronic
1134982025 16:18619061-18619083 CAGGGATAGAGGTAGGGGGAAGG + Intergenic
1136081345 16:27854325-27854347 AAGGGGGAGGAGGAGGGGGACGG + Intronic
1136135912 16:28256875-28256897 CAGGGAGAGGGGAGAGGGGAGGG - Intergenic
1136165007 16:28447963-28447985 AAGTGAGAGAGGAAGGGGGAGGG - Intergenic
1136214305 16:28781194-28781216 AAGTGAGAGAGGAAGGGGGAGGG + Intergenic
1136360893 16:29779041-29779063 CAGGGAGAGCTGGAGGGGTCAGG + Intronic
1136520895 16:30795093-30795115 CAGGGAGAAGTGAAGGGGGCTGG - Intergenic
1137493303 16:48951095-48951117 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1137556998 16:49477140-49477162 GAGGGTGAGCGGAAGGGGGAGGG + Intergenic
1137559786 16:49495173-49495195 ACGGGAGAGCAGGAGGGGGTGGG + Intronic
1137591062 16:49694191-49694213 AAGGGGGAGCAGGAGGGAGAGGG + Intronic
1137662334 16:50219674-50219696 GAGGGAGAAGAAAAGGGGGAGGG - Intronic
1137676022 16:50304274-50304296 CAGGGAGAGCTGGATGGGGATGG + Intronic
1137766663 16:50982642-50982664 CAGGGCGAGAAGAAAGGGGAAGG + Intergenic
1137768069 16:50993017-50993039 AAGGGAGAGGAGAAAGGAGAAGG + Intergenic
1137781845 16:51103973-51103995 AAGGGAGAACAGAAAAGGGAAGG - Intergenic
1137908446 16:52350916-52350938 AAGGGAAGGCAGAATGGGGAGGG - Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138307094 16:55988435-55988457 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1138412324 16:56850440-56850462 CAGGGAGTGGAGAAGGGGCCTGG - Intergenic
1138529729 16:57628483-57628505 GAGGGAGACCAGGAGGGGGCAGG - Intronic
1138552187 16:57754039-57754061 CAGGAAGAGAAGATGAGGGACGG - Intronic
1138981720 16:62277251-62277273 GAGGGAGAGAAGGAGAGGGATGG - Intergenic
1139378208 16:66514116-66514138 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1139424947 16:66873756-66873778 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139424957 16:66873781-66873803 GAGGGAGAGGAGGAGGGGGTAGG - Intergenic
1139521811 16:67487041-67487063 CAGGGAGAGGAGAAGATGGATGG + Intergenic
1139556153 16:67712285-67712307 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139946273 16:70644708-70644730 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1140209888 16:72961497-72961519 CAGGAGGAGCAGCAGGGGAATGG - Intronic
1140254351 16:73322125-73322147 CTCGGAGAGCAGAGGGAGGAAGG + Intergenic
1140627982 16:76817832-76817854 CAGGGCGGGCAGAAGTGGGGAGG - Intergenic
1140914582 16:79482862-79482884 GAGGGAGAGGAGGAGAGGGAGGG - Intergenic
1141224452 16:82101694-82101716 CAAGGAGAAGAGAAGGCGGAGGG + Intergenic
1141619159 16:85227678-85227700 CAGGCAGAGAGGAAGTGGGAGGG + Intergenic
1141677143 16:85523892-85523914 CAGGCTGAGCAGAGGTGGGAGGG + Intergenic
1141845133 16:86603444-86603466 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845144 16:86603501-86603523 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845155 16:86603558-86603580 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845166 16:86603615-86603637 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845177 16:86603672-86603694 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141845188 16:86603729-86603751 GAGGAAGAGCAGGAGGAGGAAGG - Intergenic
1141928442 16:87184538-87184560 CATGGAGATCTGAAGCGGGAGGG + Intronic
1141974117 16:87503409-87503431 CAGGGAGCGCAGAAGTGCCAGGG + Intergenic
1142251414 16:88993677-88993699 GAGGAAGAGAAGAAGGGGAAAGG - Intergenic
1142251454 16:88993793-88993815 GAGGGAGAGAAGAAGGGGGAGGG - Intergenic
1142431487 16:90030722-90030744 CTGGGAGAGCTGAGGTGGGAGGG - Intronic
1142541726 17:664920-664942 CAGGGAATGCAGGAGGAGGACGG + Intronic
1142578813 17:927623-927645 CAGGAGGAGCAGAAGGAGGCGGG + Intronic
1142711341 17:1725454-1725476 CAGGGACAGCTGAGGGGGCAGGG - Exonic
1142889271 17:2932423-2932445 CAGGGAGAGGAGAGGGAGGAAGG + Intronic
1142964688 17:3573279-3573301 CCTGGAGGGAAGAAGGGGGAGGG - Intronic
1143129947 17:4671869-4671891 CAGGGAGAGGTGGAGAGGGAAGG - Exonic
1143255902 17:5557960-5557982 CAGAGAGAGGAGCAGGGGTAGGG + Intronic
1143325608 17:6096374-6096396 CAGGGAGAGCGGGAGTGGGGGGG - Intronic
1143382132 17:6503161-6503183 CAGAGAGAGGAGGACGGGGATGG - Intronic
1143391418 17:6561243-6561265 AAGGAAGAGGAGAAGGAGGAAGG - Intergenic
1143483423 17:7239532-7239554 GAGGGAGAGAAGAGGAGGGAGGG - Intronic
1144025176 17:11271086-11271108 CAGGGAGAGAAGAGGCGGGAAGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144464339 17:15484975-15484997 CAGGGAGAGCAGATTTGGGGTGG + Intronic
1144580437 17:16456077-16456099 GAGGGAGAGGAGGAGGAGGAAGG + Intronic
1144652446 17:17015572-17015594 CAAGGAGAGCAGTAAGGGAACGG + Intergenic
1144708515 17:17385459-17385481 CAGGGGCTGCAGAGGGGGGATGG - Intergenic
1144797744 17:17903914-17903936 CAGGGAGGGCACAAAGGGGTGGG + Intronic
1145014539 17:19387671-19387693 CTGGGGGAGCAGAAGGCTGAGGG + Intergenic
1146054459 17:29574221-29574243 AAGGGAGAGCAGCAAGGGGCTGG + Exonic
1146291771 17:31612906-31612928 AAAGGAGAGGAGAAGGAGGAGGG - Intergenic
1146619882 17:34389062-34389084 CAGGGAGAGGGGAAGGAGCATGG + Intergenic
1146979508 17:37146707-37146729 AAGGGAGAGAAGAAGGAGGGGGG + Intronic
1147371580 17:39996477-39996499 CAGGGGGCCCAGAATGGGGAGGG + Intronic
1147393638 17:40124333-40124355 CAGGGAGGGAGGAAGAGGGAGGG - Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147646544 17:42037842-42037864 CAGGGAGGCCAGCAGGGGGCTGG + Exonic
1148179647 17:45595043-45595065 GAGGAAGAGGAGAAAGGGGAAGG + Intergenic
1148203237 17:45763754-45763776 CAAGGAGAGCAGACAGGGGTAGG - Intergenic
1148269257 17:46250858-46250880 GAGGAAGAGGAGAAAGGGGAAGG - Intergenic
1148383901 17:47220935-47220957 CAGCCAGAGGAGAAGGGGGACGG - Intronic
1148391478 17:47276041-47276063 AAGAGAGAGCTGAATGGGGAGGG + Intronic
1148545207 17:48513414-48513436 CAGTGAGAGTATAAGGGGGTGGG - Intergenic
1148560652 17:48604091-48604113 GAGGGATGGCAGGAGGGGGAGGG + Intronic
1148638794 17:49169491-49169513 GAGGGAGAGCAGAAGGAAGTGGG - Intronic
1148679727 17:49466671-49466693 CTGGGAGAGAAGGAGGGGAAGGG + Intronic
1148731612 17:49840129-49840151 AAGGGAGAGCAGAGGGAGAATGG - Intronic
1148798951 17:50211095-50211117 GAGGGAGAGAAGGAGGGGGGTGG - Intergenic
1148955015 17:51346318-51346340 TGGGGATAGCAGATGGGGGAGGG + Intergenic
1149107105 17:52982651-52982673 AAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1149315138 17:55431869-55431891 CAGGGGGAGGGGGAGGGGGAGGG + Intergenic
1149430509 17:56593302-56593324 CAGGAGGAGGAGAAGGGGGGTGG + Intergenic
1150067856 17:62126349-62126371 CAGGAAGAGCAGGAGGTAGAAGG - Intergenic
1150104877 17:62455357-62455379 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1150125188 17:62630571-62630593 CTGGGAGGCCAGAATGGGGATGG + Intronic
1150402758 17:64872411-64872433 CAGAGGGAGCAGAATGGAGATGG + Intronic
1150427282 17:65086716-65086738 AAGGGAGAACAGGAAGGGGAAGG - Intergenic
1150428931 17:65100603-65100625 GAGGGAGAGGAGGAGGTGGAGGG - Intergenic
1150507542 17:65714990-65715012 CAGGTGGAGCAGAAGGAGCAAGG + Intronic
1150628600 17:66859822-66859844 AAGGGGGAGGAGAAGGAGGAGGG - Intronic
1150947610 17:69765399-69765421 AGGGGAGGGAAGAAGGGGGAGGG - Intergenic
1150947659 17:69765528-69765550 AGGGGAGGGAAGAAGGGGGAAGG - Intergenic
1150964019 17:69947219-69947241 CAGGAGGAGGAGGAGGGGGAGGG - Intergenic
1151163846 17:72187782-72187804 CAGGGTGAGCAGGCGGGGGAAGG - Intergenic
1151467423 17:74296347-74296369 GAGAGAGAGAGGAAGGGGGAAGG + Intronic
1151517801 17:74607626-74607648 CATGGAGGGCAGAGGGTGGAGGG + Intergenic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151796772 17:76351859-76351881 GAGGGAGAGCAGAGGGGAGCAGG - Intronic
1152187106 17:78864369-78864391 AAGGGAGGGAGGAAGGGGGAGGG - Intronic
1152268846 17:79312000-79312022 AAGGGGGAGGAGAAGGGAGAGGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152322021 17:79613018-79613040 CATGGGGAGCTGAAGGGAGACGG - Intergenic
1152336731 17:79703140-79703162 TAGAGGGAGGAGAAGGGGGAGGG - Intergenic
1152361977 17:79837040-79837062 CGGAGAGGGTAGAAGGGGGAAGG - Intronic
1152455674 17:80414868-80414890 CGGGGACAGCAGAGGCGGGACGG + Intergenic
1152524451 17:80879503-80879525 CAGTGAGGGAAGAAGGGGAAGGG - Intronic
1152734095 17:81988504-81988526 CAGGGACAGCAGGAGGTGGTGGG + Intronic
1152840066 17:82561626-82561648 CGGGGAAAGGAGAAGGGCGAGGG + Intronic
1153006843 18:504638-504660 CAGGGAGAAAAGAAGGGAAAAGG + Intergenic
1153321088 18:3774918-3774940 CAGGGAGTGCAGGAGGTGGTGGG - Intronic
1153528067 18:6016212-6016234 CCGGGGGAGCAGCAGGGGCACGG + Intronic
1153680639 18:7497346-7497368 AAGGAAGAGGAGAAGGAGGAAGG + Intergenic
1153717933 18:7869491-7869513 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
1153732223 18:8025934-8025956 CAGGGAGAGCAGAAGGAGAAAGG + Intronic
1153781769 18:8501071-8501093 CAGGGAGACAGGAAGGGGCACGG - Intergenic
1153805752 18:8706811-8706833 CGTGGAGAGCAGGAGGGAGAAGG - Intronic
1153987180 18:10362851-10362873 GAGGAAGAGAACAAGGGGGAAGG - Intergenic
1154072248 18:11163144-11163166 CAATGAGAGGAGGAGGGGGAGGG - Intergenic
1154192538 18:12242908-12242930 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1154333362 18:13447744-13447766 GAGGGATGGGAGAAGGGGGAGGG + Intronic
1155068929 18:22295876-22295898 AAGGGAAAGCAGAAGAGGAAAGG - Intergenic
1155161647 18:23201041-23201063 CAGGGAGAGCAGAAGCAGGAAGG + Intronic
1155553340 18:26990867-26990889 CCTGAAGAGCAGAAGGAGGAAGG - Intronic
1155891753 18:31278816-31278838 CAGGGAGATCAGTAGTGTGAAGG - Intergenic
1155969617 18:32070005-32070027 GAGAGAGAGAAGAAGGAGGAAGG - Exonic
1156456396 18:37297046-37297068 CAGGGAGAGAAGAGGGGAGCAGG + Intronic
1156458259 18:37306802-37306824 TAAGGAGAGGAGAATGGGGAGGG + Intronic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1156514932 18:37671387-37671409 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1156561374 18:38129603-38129625 CAGTGAGAAGAGAAAGGGGAAGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1156958781 18:42997454-42997476 AAGAGAGAGAAGAAGGGGGAGGG + Intronic
1157301676 18:46484016-46484038 CTTGGAGAGCAGAGGGAGGAGGG + Intronic
1157444005 18:47731324-47731346 CCGTGAGAGCAGAATGGGGAAGG + Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157576936 18:48749907-48749929 CAGGCCGAGCGGAAGGGCGAGGG + Intronic
1157592702 18:48845130-48845152 AAGGAAGAGAAGAAGGGGGTTGG + Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157820336 18:50762964-50762986 CAGAGAGAGAAGAAGGGTGAAGG - Intergenic
1157884191 18:51350576-51350598 CAGGGAGAAGGGAAGGGGGAAGG - Intergenic
1159132293 18:64292672-64292694 CAGAGAGAGGAGAAGGGGTAAGG - Intergenic
1160050714 18:75430864-75430886 CAGGGAGTGACGAAGAGGGAAGG - Intergenic
1160178645 18:76615895-76615917 CAGGGAAGGTGGAAGGGGGATGG + Intergenic
1160182034 18:76644888-76644910 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1160182038 18:76644894-76644916 CAGGGAGAGGGAGAGGGGGAGGG - Intergenic
1160239792 18:77114920-77114942 CAGGGAGAGCAGGAATAGGAAGG - Intronic
1160673724 19:377740-377762 CTGGGAGCCCAGAAAGGGGAGGG - Intergenic
1160685120 19:431019-431041 CTGGGAGAGCAGAGCGGGGAAGG - Intronic
1160751815 19:737951-737973 CAGGGAGAACAGACCGTGGACGG + Intronic
1160819760 19:1052478-1052500 GAGGGAGAGGAGGAGGGGGAGGG + Intronic
1160819773 19:1052508-1052530 GAGGGGGAGGAGAAGGGGGGAGG + Intronic
1160819810 19:1052602-1052624 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1160900240 19:1424332-1424354 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1160936440 19:1598219-1598241 GAGGGAGAGCAGACGAGGCAGGG + Intronic
1160965660 19:1746003-1746025 GAGGGAGAGGAGGAGGGGGAAGG + Intergenic
1160965698 19:1746102-1746124 AAGGGGGAGTAGAAGGGGGAAGG + Intergenic
1160965734 19:1746195-1746217 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160965775 19:1746310-1746332 GAGGGAGAGGAGGAGGGAGATGG + Intergenic
1160965798 19:1746366-1746388 GAGGGAGAGGAGGAGGAGGATGG + Intergenic
1160974033 19:1783726-1783748 CAGGGAGAACAGAGGTGGCAGGG + Intronic
1161093921 19:2377656-2377678 AAGGGAGAGAGGGAGGGGGAGGG - Intergenic
1161166242 19:2789356-2789378 CAGCGAGAGCAGCTGCGGGAAGG - Intronic
1161200010 19:3009432-3009454 AAGGGAGTGCAGAAAGGGAAGGG - Intronic
1161266339 19:3366463-3366485 GAGGGAGAGCAGGAGGGAGGAGG + Intronic
1161332885 19:3696715-3696737 CAGGGAGGGCAGAGTGCGGAGGG + Intronic
1161366955 19:3885602-3885624 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1161403794 19:4080919-4080941 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1161453298 19:4358345-4358367 GAGGGAGGGCAGAAGTTGGAGGG - Intronic
1161456671 19:4373110-4373132 GAGGGAGAGGAGCAGTGGGAGGG + Intronic
1161620358 19:5293922-5293944 GAGGGAGAGGAGGAGGGAGAGGG + Intronic
1161756580 19:6138472-6138494 GAGAGAGAGGGGAAGGGGGAAGG + Intronic
1161814325 19:6490307-6490329 GAGGGAGAGAAGAGGGAGGAAGG - Intergenic
1161821494 19:6533434-6533456 GATGGAGAGGGGAAGGGGGAAGG - Intronic
1161829061 19:6589788-6589810 CAGGGAGAGTGGAAGAGGGAGGG - Intronic
1162038107 19:7953384-7953406 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162038143 19:7953479-7953501 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
1162053089 19:8046797-8046819 GAGGGGGAGGAGAAGGAGGAGGG - Intronic
1162082237 19:8225104-8225126 CAGGGAGAGCAGATGGTGTGAGG + Intronic
1162101553 19:8342407-8342429 CAGGGAGCGGAGGAGAGGGAAGG - Intronic
1162301179 19:9846051-9846073 CAGGGAGAGGAGGGGTGGGAGGG + Intronic
1162351090 19:10150196-10150218 GTGGCAGAGCAGAAGTGGGAGGG - Intronic
1162731169 19:12719867-12719889 CAGCCAGAGCAGGAGAGGGAAGG + Intronic
1162917079 19:13880468-13880490 GAGGGAGAGCAGGAGGGCGAAGG - Exonic
1162958402 19:14112479-14112501 CAGGGAGAGCCCAAGGGGGCTGG - Intronic
1162973199 19:14193477-14193499 CTGGGAAGGCTGAAGGGGGAGGG + Intronic
1162984119 19:14258384-14258406 CAGGAGGAGGAGCAGGGGGAAGG - Intergenic
1163004528 19:14389193-14389215 GAGGGAGAGGGGTAGGGGGAGGG + Intronic
1163004561 19:14389259-14389281 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
1163062583 19:14771173-14771195 CAGGGAGAACAGGAGGGACAGGG + Intronic
1163213925 19:15862474-15862496 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1163370959 19:16901049-16901071 GAGGGGGAGGGGAAGGGGGAGGG + Intronic
1163424978 19:17236145-17236167 GAGGGACAGGAGATGGGGGAGGG + Intronic
1163548584 19:17952839-17952861 CCGGGAGAGGGGAGGGGGGAAGG - Intronic
1163580343 19:18135059-18135081 CAGGGAGAGAAGCAGGAAGAGGG + Intronic
1163594875 19:18215225-18215247 CAGGGTGTGCAGAATGAGGAAGG - Intronic
1163695797 19:18762661-18762683 CAGGGAGAGCTGCCAGGGGAGGG - Intronic
1164082007 19:21866851-21866873 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1164406899 19:27957248-27957270 AAGAGAGAGGGGAAGGGGGAAGG + Intergenic
1164511823 19:28903906-28903928 TAGGGAGTGCAGAAGGGTGATGG - Intergenic
1164667865 19:30053407-30053429 CAGGGAGCTCCGAAGGGGCAGGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164729129 19:30488754-30488776 CAAGGGGAGAAGAAAGGGGAGGG - Intronic
1164843587 19:31413080-31413102 CATGGAGAGCAGTAGGTGGGTGG - Intergenic
1164912365 19:32023313-32023335 AAGAAAGAGCAGAGGGGGGAGGG + Intergenic
1164925600 19:32127678-32127700 GAGGGAGGGAGGAAGGGGGAGGG + Intergenic
1164956612 19:32392129-32392151 CAGGGAGGAAAGAAGGGGGAGGG + Intergenic
1165100537 19:33436115-33436137 CGGGGAGAAAAGAAGGGAGAAGG + Intronic
1165146535 19:33734636-33734658 CAGGGAGAGGAGAGGAAGGAGGG + Intronic
1165254669 19:34568511-34568533 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1165707459 19:37986721-37986743 CAGGAAGAGGGGAAAGGGGAAGG - Intronic
1165757232 19:38300999-38301021 CAGAGAGAGCAGAAGGAGAGAGG - Intronic
1165792933 19:38502804-38502826 CAGGGGGAGGAGCAGGGGCAGGG + Intronic
1165842824 19:38798794-38798816 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1166002465 19:39885962-39885984 GAGGGAGAGCCGGAGGGGCAGGG - Intronic
1166005250 19:39902214-39902236 GAGGGAGAGCCGGAGGGGCAGGG - Intronic
1166065503 19:40356128-40356150 CAGGGAAAGCAGCTGTGGGAGGG + Intronic
1166122493 19:40693934-40693956 CAGGGGGAGCAGAGAGGGAATGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166163282 19:40967443-40967465 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1166181758 19:41113781-41113803 CAGGGAGAGAAGCAGAGAGAAGG + Intergenic
1166190900 19:41175925-41175947 CAGGGGGAGTAGAAGAGGGGTGG - Intergenic
1166299755 19:41907006-41907028 CAGGGAGAGCAGAGAGAGAAGGG - Intronic
1166369639 19:42293714-42293736 CAGCGAGAGCAGCAGTGGGCGGG + Exonic
1166536063 19:43575518-43575540 CAGGGAGAGTGGGAGGGGGCGGG + Exonic
1167295580 19:48646944-48646966 GAGGGAGAGGAGGAGGGGGAGGG + Intergenic
1167377439 19:49119513-49119535 CAGTGAGAGCGTGAGGGGGAGGG + Exonic
1167435028 19:49474345-49474367 CAGGGGGAGCAGAGGGTGGGGGG + Intronic
1167482968 19:49744524-49744546 CAGTCAGAGCAGAGAGGGGAGGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167646847 19:50710654-50710676 AAGGGAGTGCTGAAGGGAGATGG - Intronic
1167794055 19:51697657-51697679 CAGAGGGAGCAGCAGGGAGATGG + Intergenic
1167960626 19:53102244-53102266 CAGGGAGAGCAGAGGAGGCGCGG - Intronic
1167986799 19:53325247-53325269 CATGGATGGCAGAAGGGGGATGG - Intergenic
1168098916 19:54130653-54130675 CAGGGAGGGGAGGAGGTGGAAGG + Intronic
1168691765 19:58381702-58381724 GAGGGGGAGAAGGAGGGGGAGGG - Intergenic
925059960 2:883452-883474 CAGGGGGAGCAGCAGAGGGCTGG + Intergenic
925132452 2:1503469-1503491 CAGGGGGAGCAGGAGCAGGAGGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925238231 2:2297730-2297752 CTGGGAGGGCAGAAGGAGGAGGG - Intronic
925310229 2:2876552-2876574 CAGGGAGAGCGGCTGGGAGAAGG - Intergenic
925454372 2:4002745-4002767 CAAGGAGAGGGGAAGAGGGATGG - Intergenic
925587192 2:5475545-5475567 GAGGGAGAGGAGAAGGGGCCTGG + Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925927592 2:8681684-8681706 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
926215730 2:10903888-10903910 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
926675239 2:15613026-15613048 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
926685001 2:15691486-15691508 CAGGAAGATGACAAGGGGGACGG - Intronic
927292923 2:21422282-21422304 CAGGGAGAGGAGAAGAAGGAGGG + Intergenic
927293955 2:21431990-21432012 CAGGGAGAACAGAAGCAGTAAGG + Intergenic
927481830 2:23459977-23459999 CAGGTAGAGGAGAAGCTGGAAGG + Intronic
927703134 2:25280518-25280540 CAGCGCGAGCTGAAGGGCGAAGG - Intronic
927963495 2:27255193-27255215 GAGGGAGAGAGGAAGGGGTATGG + Exonic
928076441 2:28269275-28269297 GATGGAGAGGAGAAGGGGGAAGG - Intronic
928158232 2:28895383-28895405 AAGGGGGGGCAGGAGGGGGAAGG - Intronic
928172981 2:29015288-29015310 GAGGGAGCGCAGAAGTGGGGTGG - Intronic
928196239 2:29218554-29218576 GAGGGAGAGAGAAAGGGGGAGGG + Intronic
928274088 2:29883083-29883105 AAGGGAGAGAGGAAGGAGGAAGG + Intronic
928542371 2:32295044-32295066 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
928687351 2:33762185-33762207 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
929112332 2:38415399-38415421 CTGGAAGAGCAGAAGAGTGATGG - Intergenic
929152100 2:38756730-38756752 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
929238514 2:39629226-39629248 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
929333625 2:40713249-40713271 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
929442242 2:41973362-41973384 CCGGGAGAGAAGAAGGGGCTGGG - Intergenic
929444503 2:41991951-41991973 GAGGGAGAAGAGGAGGGGGAGGG + Intergenic
929456465 2:42069555-42069577 CCAGGAGGGCAGAAGGGAGAAGG - Intergenic
929577951 2:43064025-43064047 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
929691286 2:44076089-44076111 CAGGGTGAGCAGGCTGGGGAGGG + Intergenic
929739336 2:44587438-44587460 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
929754217 2:44750445-44750467 CAGGGACAGCAGACAGGGCACGG - Intronic
929822458 2:45284317-45284339 CAGGGAGGGCAGGAGGGGAAGGG - Intergenic
930019408 2:46992357-46992379 CAGGCAGGGCAGCATGGGGAGGG + Intronic
931007199 2:57865240-57865262 GAGGAAGAGGAGAATGGGGATGG + Intergenic
931212171 2:60207609-60207631 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
931517246 2:63057202-63057224 GAGGAAGAGCAGAAGGGGGACGG - Exonic
931533536 2:63245455-63245477 CTTGGAGAGCAGAAGGGTGTTGG + Intronic
931576219 2:63721710-63721732 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
931630715 2:64296140-64296162 CATGAAGAGCAGAATAGGGAAGG - Intergenic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932088128 2:68780598-68780620 AAGGAAGGGGAGAAGGGGGAAGG - Intronic
932253967 2:70267781-70267803 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932421164 2:71602333-71602355 GAGGGAGAGCTGGAGGGGCAGGG - Intronic
932593723 2:73081563-73081585 CAGTGGGAGCAGGAGTGGGAGGG + Intronic
932610018 2:73191950-73191972 CAGGGGAAGCAGGAGGGGCAGGG + Intergenic
932623317 2:73279603-73279625 AAGTAAGAGCAGAAGAGGGAAGG + Intronic
932654670 2:73600203-73600225 AATGGAGACCAGAAGTGGGAAGG + Intronic
932662824 2:73671835-73671857 AATGGAGACCAGAAGTGGGAAGG + Intergenic
932952444 2:76310055-76310077 CAGGGAGAGGGGTAGGGAGAAGG - Intergenic
932993121 2:76812770-76812792 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
933091220 2:78119845-78119867 GAGGGAGAGAATAAGGAGGAAGG + Intergenic
933156624 2:78982585-78982607 AAAGGAGAGCAGAAGGAGGCTGG - Intergenic
933260107 2:80122995-80123017 CAGAGACAGCAGAAGTGAGACGG - Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933438728 2:82282598-82282620 TAGGGAGGCCAGAAGGGGGATGG + Intergenic
933488368 2:82950819-82950841 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
933633310 2:84680679-84680701 CAGGGAGACCAGAATGGAAATGG + Intronic
933718179 2:85377386-85377408 CAGGTAGAGCAGATGCAGGAGGG - Exonic
933772659 2:85754075-85754097 AAGGGAGAGAGGGAGGGGGAGGG + Exonic
933847881 2:86339834-86339856 CAGGGGGAGCAGCGGAGGGATGG + Intergenic
934652329 2:96099761-96099783 GAGGGGGAGATGAAGGGGGAGGG + Intergenic
934882302 2:97995258-97995280 CAGTGACAGGAGACGGGGGAAGG + Intronic
934883491 2:98004688-98004710 AAGGGAGAGGAGGAGGAGGAGGG - Intergenic
934931517 2:98429604-98429626 CAGGGGGAGGATAAGAGGGAGGG + Intergenic
934936004 2:98465896-98465918 CAGCCAGAGAGGAAGGGGGAGGG - Intronic
935622799 2:105144034-105144056 GAGGGAGAGGAGGAGGAGGACGG - Intergenic
935837541 2:107071947-107071969 CAGGGAGTGGGGTAGGGGGAGGG - Intergenic
936266960 2:111018212-111018234 CAGGGAGAGGGGACGGAGGAGGG + Intronic
936489358 2:112957135-112957157 CAGTAAGAGCAGGAGGGTGAAGG - Intergenic
936600334 2:113889525-113889547 CAGGGTGAGCAGTCGGGGAACGG - Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936986434 2:118315347-118315369 CAGGGAGAGCAGAAATGGCTGGG - Intergenic
937150511 2:119682828-119682850 CAAGGAGAGCAGAGGGGTGGAGG + Intronic
937168939 2:119845236-119845258 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
937227251 2:120377064-120377086 CAGAGAGAACAGAAGAGGAAAGG - Intergenic
937735023 2:125277782-125277804 CAGGGAGAGGGAGAGGGGGAGGG + Intergenic
937735027 2:125277788-125277810 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
937768812 2:125694930-125694952 CAGGGAGAGAAGAAGGAGTGAGG + Intergenic
937787561 2:125920570-125920592 CAGGCAGACCAGAAGTTGGAGGG + Intergenic
938079578 2:128362640-128362662 CAGGGAAAGCAGACAGGGGATGG - Intergenic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938120089 2:128627001-128627023 GAGGGAGAGGAGGAGGAGGAGGG + Intergenic
938137165 2:128769048-128769070 TAGGAAGAAGAGAAGGGGGAGGG + Intergenic
938528627 2:132161775-132161797 CAGGGACTGAAGAAGGGCGAGGG - Exonic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938811257 2:134855052-134855074 AAGGGAGAGGAGAGGGGTGATGG - Intronic
938925607 2:136038803-136038825 CAGAGAAAGCAGAAAGGGAAGGG - Intergenic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939479917 2:142734895-142734917 CAAGGAGAGAAGTTGGGGGAAGG + Intergenic
939855385 2:147352758-147352780 CAGAGAGAGAAGAATGAGGAAGG + Intergenic
940054624 2:149500507-149500529 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940344966 2:152619585-152619607 CTGGGAGAGGAGGAGGCGGAGGG - Exonic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038220 2:160590576-160590598 GAGGGAGAGGAGAAGGGGAAGGG - Intergenic
941038230 2:160590600-160590622 AAGGGGGAGGAGAAGGGGAAGGG - Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941197401 2:162469677-162469699 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
941477963 2:165971643-165971665 GAGGGAGAGCAGAAGCAGGGTGG + Intergenic
941540267 2:166773478-166773500 GAGGGAGAGCAGAGGCGGGCTGG - Intergenic
941623420 2:167804468-167804490 TGGGGTGGGCAGAAGGGGGAGGG - Intergenic
941788778 2:169527711-169527733 CATGGACAGCAGTTGGGGGATGG - Intergenic
941809240 2:169739003-169739025 GAGGGAGAGGAGATGGGGGAGGG - Intronic
942208596 2:173648226-173648248 CAGAGAAAGCAGGACGGGGAGGG + Intergenic
942211274 2:173673433-173673455 CAGGGAGAGCGAAACAGGGAAGG - Intergenic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942490607 2:176485942-176485964 TAGGGAGAGTAAAAGGGAGAAGG + Intergenic
943811846 2:192196345-192196367 CGGGGGGAGAAGAAGGAGGAGGG - Intergenic
944100374 2:196019937-196019959 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
944255141 2:197618050-197618072 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
944257790 2:197641401-197641423 CTGGGAGAGAAGAAGAGGGAGGG + Intronic
944533224 2:200684721-200684743 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
944533238 2:200684745-200684767 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
944533258 2:200684781-200684803 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
944822432 2:203444047-203444069 AAGGGAGAGAAGGAAGGGGAGGG + Exonic
944853613 2:203744848-203744870 CAGTCATGGCAGAAGGGGGAAGG - Intergenic
945275083 2:207980196-207980218 CAGGGAGATAAGAAGAGGGGAGG - Intronic
945395244 2:209307853-209307875 CTGGGAGTGCAGAAGGGGGCAGG + Intergenic
945400973 2:209382437-209382459 CAGGGATTGCAGAAGGTAGAGGG + Intergenic
945506439 2:210647113-210647135 CAAGGAGAGGGGAAGGTGGAAGG + Intronic
946053205 2:216880819-216880841 GTGGGGAAGCAGAAGGGGGAGGG - Intergenic
946125403 2:217558252-217558274 GAGGGAGAGAAGAAGAGTGAGGG + Intronic
946170610 2:217893128-217893150 AAGGGAGAACATAAGGAGGAAGG + Intronic
946398218 2:219454061-219454083 CATGAAGAGCAAGAGGGGGAGGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946519117 2:220446687-220446709 GAGGGAGGGGAGAAGGGGGGAGG - Intergenic
946519147 2:220446759-220446781 AAGGGAGGGAGGAAGGGGGAGGG - Intergenic
946683184 2:222239339-222239361 CAGAGAGAGAAGGAGGGGGGAGG + Intronic
946751644 2:222897914-222897936 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
946850120 2:223897772-223897794 CAAGGAGAGCACCAAGGGGATGG - Intronic
947029984 2:225782787-225782809 GAAGGAGAGAAGAAGGGCGAAGG - Intergenic
947047882 2:226008851-226008873 AAGGAAGAGCAGACGGAGGAGGG + Intergenic
947364595 2:229381118-229381140 GAGGGCGAGCAGAAGCAGGATGG + Intronic
947445095 2:230157167-230157189 AAGAGAAAGCAGCAGGGGGAAGG - Intergenic
947475944 2:230447835-230447857 CAGGGAGGGGAGAGGAGGGATGG - Intronic
947608601 2:231507547-231507569 GAGGAAGAGGAGGAGGGGGAAGG - Intergenic
947722939 2:232380341-232380363 CAGGGGGCACAGCAGGGGGAGGG + Intronic
947745701 2:232506338-232506360 CAGGGAGAGAAGAAGCAGAAAGG + Intergenic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948237744 2:236403119-236403141 AAGGAAGAGGAGGAGGGGGAGGG + Intronic
948351901 2:237347681-237347703 CAGGGATAGCACAGGGTGGAAGG - Intronic
948523402 2:238556446-238556468 GAGAGAGAGTAGAAGGGGGCAGG + Intergenic
948538971 2:238672223-238672245 GAGGAAGAGGAGAAGGAGGAGGG - Intergenic
948539716 2:238681387-238681409 AAGGGATGGCAGAAGGGAGAAGG - Intergenic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
1168978200 20:1983666-1983688 CAGGGAGGCCAGCAGGGAGAGGG - Intronic
1169260497 20:4134829-4134851 GAGGGAGAACTGAAGGAGGAGGG + Intronic
1169634135 20:7668326-7668348 TAGGCAGAGCAGAAGGGAGACGG + Intergenic
1169787172 20:9371456-9371478 GAGGGAGAGAGGAAGGGAGAGGG - Intronic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170624619 20:18021773-18021795 GAAGGAGAGAAGAAGGTGGAAGG + Intronic
1170645528 20:18193882-18193904 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1170802374 20:19601170-19601192 CAGGTAGAGGAGAAGGCGAATGG - Intronic
1170953410 20:20956575-20956597 CAGGGAATGCAGACGTGGGAGGG + Intergenic
1171124258 20:22587592-22587614 CAGGGAGAGCAGAGGAGGCCTGG - Intergenic
1171248753 20:23633461-23633483 CAGGGAGAGCAGCCAGGGGCTGG - Intronic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171474534 20:25397861-25397883 AAGGGAGAGGGAAAGGGGGAGGG + Intergenic
1172160817 20:32866752-32866774 GAGGAAGGGAAGAAGGGGGAGGG - Intronic
1172162020 20:32875403-32875425 CAGGGGGCACAGAAGGGAGATGG - Intronic
1172180432 20:33000236-33000258 CAGGGAGAGAAGAAGGGATAGGG - Intronic
1172209400 20:33186214-33186236 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1172292144 20:33784157-33784179 GAGGGAGAGGAGTAGGGAGAGGG - Intronic
1172392367 20:34574595-34574617 CAGGCAGAGGAGAAGGGGGCCGG - Intronic
1172536923 20:35681037-35681059 CAGAGAGGGAGGAAGGGGGAAGG - Intronic
1172696426 20:36826305-36826327 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1172696436 20:36826323-36826345 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1173144213 20:40510854-40510876 CAGGGAGGAAAGAAGGAGGAAGG + Intergenic
1173313072 20:41917678-41917700 GAGGGAGTGGGGAAGGGGGAGGG + Intergenic
1173423145 20:42920442-42920464 GAGGGAGAGAAGGAAGGGGAGGG + Intronic
1173465212 20:43275514-43275536 CAGGGAGTGGAGTAGGGGGTGGG - Intergenic
1173500682 20:43550553-43550575 CTGGGAGCGCAGAGAGGGGAGGG + Intronic
1173575958 20:44113100-44113122 CAGGGTGGGAGGAAGGGGGATGG + Exonic
1173596010 20:44258710-44258732 GAGGGAGAGAAGGAGGAGGAAGG - Intronic
1173938923 20:46893949-46893971 CAGGGAGACTAAAAGGGGGGTGG + Intergenic
1174136779 20:48385333-48385355 CAGGTCGAGCGGAAGGGGCAGGG - Intergenic
1174344678 20:49921426-49921448 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1174449095 20:50608981-50609003 CAGGGAGAGTGGAAGGCGGAGGG - Intronic
1174489015 20:50879206-50879228 CAGGGAGAGCACACGTTGGATGG + Intronic
1174588222 20:51625107-51625129 CAGGGAGATCACAGGGGGAAAGG - Intronic
1174759798 20:53195825-53195847 GAGGGAGGGCAGAAGAGAGAAGG - Intronic
1174968725 20:55249623-55249645 GGTGGAGAGTAGAAGGGGGATGG - Intergenic
1175120092 20:56710616-56710638 GAGGTAGAGGGGAAGGGGGAAGG - Intergenic
1175120220 20:56710994-56711016 GAGGGAGAGGAGGTGGGGGAAGG - Intergenic
1175303078 20:57956790-57956812 CAGTGAGGGCAGAAAGGGGCTGG - Intergenic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175490979 20:59381147-59381169 CAGGGAGCAGAGAAGGGTGAAGG - Intergenic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175644421 20:60658825-60658847 TCGGGGGAGCAGCAGGGGGAGGG + Intergenic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175756443 20:61533290-61533312 CTGGGCGAGCAGCACGGGGAAGG + Intronic
1175814892 20:61878209-61878231 CAGGGGGAACAGAAGGTGGGAGG - Intronic
1175891585 20:62318245-62318267 GAGGAAGAGGAGGAGGGGGAGGG + Intronic
1175959238 20:62626635-62626657 CTGGAAGAGCAGGAGGGGGAGGG - Intergenic
1176239013 20:64067386-64067408 CCGGGAGAGGGGAAGCGGGAGGG + Intronic
1176379201 21:6103367-6103389 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176379221 21:6103421-6103443 CAGGGGCAGCAGCAGGGGCAGGG + Intergenic
1176513650 21:7767340-7767362 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1177299256 21:19219568-19219590 AAGAGAAAGCAGAAGGGGAAGGG + Intergenic
1177564109 21:22796209-22796231 TGGGGAGACCAGAAGGGAGATGG + Intergenic
1177844051 21:26268102-26268124 TGGGGAGGGCAAAAGGGGGATGG + Intergenic
1178372993 21:32042709-32042731 CAGGGCGGGCAGAAGGGGGTGGG + Intronic
1178647763 21:34397864-34397886 AAGGGAAAGAGGAAGGGGGACGG - Intronic
1178748297 21:35274969-35274991 GAGGGAGAGCAGAAGGAGGTGGG - Intronic
1178759286 21:35385270-35385292 CAAGGAGAGCAGAAGGAGAGAGG + Intronic
1179034922 21:37751410-37751432 CAGGGAGAGCAAACGGGAGGTGG + Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179215866 21:39366817-39366839 AAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1179422646 21:41248912-41248934 CAGGGAGAGTCCAAGGAGGAGGG - Intronic
1179434277 21:41349673-41349695 GAGGTAGAGGAGAAGGGGGCTGG + Intronic
1179744252 21:43434816-43434838 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1179744272 21:43434870-43434892 CAGGGGCAGCAGCAGGGGCAGGG - Intergenic
1180003562 21:45007607-45007629 CTCGGAGAGCAGAAGGGGGATGG - Intergenic
1180782436 22:18528729-18528751 CAGGGCGGGCGGAAGGGGGCGGG + Intronic
1180793967 22:18592831-18592853 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1180861107 22:19083695-19083717 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1180872501 22:19154584-19154606 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1180938287 22:19640286-19640308 CAAGGGGAGGAGAATGGGGATGG - Intergenic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181125989 22:20702756-20702778 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181227773 22:21402489-21402511 AAGGGAGGGGAGAATGGGGAAGG - Intergenic
1181239326 22:21468064-21468086 CAGGGCGGGCGGAAGGGGGCAGG + Intergenic
1181250879 22:21532350-21532372 AAGGGAGGGGAGAATGGGGAAGG + Intergenic
1181775971 22:25160526-25160548 GAGGGAGAGCAGAAGAGGAGAGG - Intronic
1181792496 22:25278641-25278663 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1181830699 22:25558220-25558242 CAGGGAGAAGGGAAGTGGGAGGG + Intergenic
1181907336 22:26209769-26209791 GAGGGAGGGAAGAAGGAGGAAGG + Intronic
1181999124 22:26905713-26905735 CAGAGAGAGAAGAGAGGGGAGGG + Intergenic
1182046229 22:27276255-27276277 CAGTCATAGCAGAAGGGGAAGGG - Intergenic
1182082445 22:27538892-27538914 CAGGGAAGGAGGAAGGGGGAGGG - Intergenic
1182268084 22:29135049-29135071 CAGGGAGAGAAGAAGGGTGTGGG - Intronic
1182356752 22:29725635-29725657 CAGGGAGGGCACCAGGGAGATGG + Intronic
1182358398 22:29733165-29733187 CAGAGGGAGCTGAAGTGGGAAGG - Intronic
1182508651 22:30803184-30803206 CAGGGCGGGCGGAAGAGGGATGG + Intronic
1182680703 22:32077314-32077336 GGGGGAGAGAGGAAGGGGGAGGG - Intronic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183195661 22:36351879-36351901 TACCGAGAGCAGAAGGGGCAGGG + Intronic
1183206936 22:36426251-36426273 CAGGGAGAGGAGGAAGAGGAAGG - Intergenic
1183298812 22:37048201-37048223 CAGGGAGGGAGAAAGGGGGAGGG - Intergenic
1183339871 22:37274199-37274221 AAGGGGGAGCAGCAGAGGGATGG - Intergenic
1183419741 22:37704465-37704487 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1183546659 22:38457760-38457782 CAGGGAGAGGAGGAAGGGGCAGG + Intergenic
1183623009 22:38985789-38985811 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183629562 22:39025047-39025069 CTGGGAGAGGAGCAGGGGCAGGG - Intronic
1183633014 22:39044918-39044940 CTGGGAGAGGAGCAGGGGGCAGG - Intronic
1183733177 22:39629553-39629575 GACGGAGAGGAGCAGGGGGACGG + Intronic
1183754399 22:39746734-39746756 CTGGGAGGCCAGCAGGGGGAGGG + Intronic
1183786883 22:40034480-40034502 CTGGGAGAGCAGAAGCTGCAAGG - Exonic
1184202440 22:42980486-42980508 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184834823 22:47014913-47014935 CAGGCAGCTCAGAAGGGAGAGGG - Intronic
1184982752 22:48105825-48105847 CAGGGAGAGCAGAGGGATGTGGG - Intergenic
1185032796 22:48453563-48453585 CTGAGAGAGCAGATGGGGCAAGG + Intergenic
1185106949 22:48877194-48877216 GAGGGAGAGAGGAAGGAGGAAGG - Intergenic
1185295276 22:50049950-50049972 CAGGGAGGCCAGGAGGGTGATGG + Intronic
1185345177 22:50307756-50307778 GAGGGGGAGAAGGAGGGGGAGGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949311874 3:2709057-2709079 CAGTGGCAGCAGAGGGGGGATGG - Intronic
949551559 3:5116203-5116225 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
949667632 3:6358703-6358725 CAGGAAGAGAAGAAGGAGAAAGG - Intergenic
949724441 3:7027017-7027039 CAGGCAGAACACAATGGGGAGGG - Intronic
949853149 3:8439028-8439050 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
949992487 3:9591292-9591314 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
950044439 3:9940710-9940732 GAGGGAGAGGGAAAGGGGGAGGG + Intronic
950188874 3:10962497-10962519 AAGGGAGAGGAGAAGAGGGTAGG + Intergenic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950289809 3:11774552-11774574 CAGGGAGAGCAGTAGGGCCCTGG - Intergenic
950401586 3:12773204-12773226 GAGGGAGAGAGGAAGGAGGAAGG + Intergenic
950703424 3:14765970-14765992 CAAACAGAGCAGAAGGGTGAGGG + Intronic
950841660 3:15973949-15973971 GAGGAAGAGGAGAAGGAGGAAGG - Intergenic
951080335 3:18444869-18444891 AAGGAAGAGAAGGAGGGGGAGGG + Intronic
951080352 3:18444908-18444930 CGGGGGGGGGAGAAGGGGGAGGG + Intronic
951264901 3:20553199-20553221 CAGGGAGGGCAGAGGGGCGTGGG + Intergenic
951629196 3:24699764-24699786 GAGGGAGAGCAGAAGCAGGGTGG - Intergenic
951747877 3:25999361-25999383 CAGGGTGAGCACAAGGGGTCAGG - Intergenic
951964986 3:28372024-28372046 CAGGAAGAGAAGGAGGAGGAGGG - Intronic
952979056 3:38720626-38720648 AAGGGAGAGCTGCAGGGGGCGGG + Intronic
953311019 3:41879355-41879377 GAGGGAGAGAAAAAGGGAGAGGG + Intronic
953397666 3:42585945-42585967 CTGGGAGAGCAAGCGGGGGAGGG - Intronic
953420901 3:42752470-42752492 CCGGGAGAGCTGAAGTTGGAAGG - Intronic
953440298 3:42910346-42910368 GAGGGAGAGGGGGAGGGGGAAGG + Intronic
953621000 3:44532718-44532740 CAGCGAGAGCAAATGGGGGTAGG + Intergenic
953870127 3:46619112-46619134 ATGGGAGTGCAGAAGAGGGAGGG - Intronic
954060219 3:48061186-48061208 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
954326756 3:49868270-49868292 AAAGGATAGCAGATGGGGGAGGG - Intronic
954399798 3:50312966-50312988 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
954411843 3:50374311-50374333 GAGGGGGAGGAGAAAGGGGAGGG + Intronic
954411854 3:50374334-50374356 TAGGGGGAGGAGGAGGGGGAAGG + Intronic
954436691 3:50500052-50500074 CAGGGAGAGCCACAGGGAGATGG + Intronic
954481527 3:50804758-50804780 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
954573545 3:51662365-51662387 CAGGGAGAGAAGAAGGGTAGAGG - Intronic
954634363 3:52063581-52063603 CAGGACGAGGAGAAGAGGGAGGG - Intergenic
954634592 3:52064695-52064717 CAGGCAGAGGAGAAGGGGAAAGG + Intergenic
954792596 3:53144234-53144256 CTGGGACAGCAGAATGGAGAAGG - Intergenic
954870434 3:53763614-53763636 CAGGCAGAGCATCAGGGGCAGGG - Intronic
955034879 3:55257926-55257948 GTGGGAGAGAGGAAGGGGGAGGG - Intergenic
955087809 3:55720075-55720097 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
955175059 3:56605878-56605900 GAGGCAGAGCACCAGGGGGAAGG - Intronic
955395889 3:58556909-58556931 CAGGGAAGGAGGAAGGGGGAAGG + Intergenic
955523802 3:59800834-59800856 GGGGGAGAGAAGAAAGGGGAGGG + Intronic
955945215 3:64187387-64187409 AAGGGAGGGAAGAAGGGGGCAGG - Intronic
956190289 3:66601723-66601745 GAGGGGGAGGAGCAGGGGGAGGG - Intergenic
956214210 3:66831833-66831855 AAGGGTGGGCAGAAGGGGGAAGG - Intergenic
956621005 3:71221494-71221516 AAGGGAGGGCAGAAGGATGAAGG - Intronic
957479235 3:80770132-80770154 TGGGGAGATCAGAAGGGGAATGG + Intergenic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
958163667 3:89851431-89851453 AGGGGAGAGGAGAAGGAGGAAGG + Intergenic
958431174 3:94043557-94043579 GAGGGAGAGGGGAAGAGGGAGGG - Intronic
958732586 3:97974516-97974538 GAGGGAGGGAGGAAGGGGGAGGG + Intergenic
958870946 3:99558322-99558344 CTGGGACAGTAGATGGGGGAAGG + Intergenic
959279097 3:104315806-104315828 CAGAGATAGCACTAGGGGGATGG + Intergenic
959415933 3:106075785-106075807 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
959946737 3:112133237-112133259 CAGAGACAGCAGAAAGGAGAAGG + Exonic
960051254 3:113241414-113241436 CCGGGAGAGCAGAGGGGGAGAGG - Intronic
960319009 3:116211177-116211199 CAGGGATGGGAGGAGGGGGAAGG + Intronic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
960987696 3:123291432-123291454 CACGGAGAGGAGGAGGTGGAGGG - Intronic
961144762 3:124584694-124584716 CGGGGAGAGCACAGCGGGGAGGG + Intronic
961314212 3:126023419-126023441 CAGGGAGGGCAGGAGGGAGCTGG + Intronic
961488243 3:127232510-127232532 CAGGGAGGTCAGCAGGAGGATGG - Intergenic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961977431 3:131041947-131041969 GAGGGCGAGCAGAAGGAGGGTGG + Intronic
962134934 3:132722724-132722746 GAGGGAGAGCGGAAGGGGGTGGG + Intergenic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203467 3:133417420-133417442 GAGGGTGAGTAGAAGGGAGAGGG - Intronic
962319829 3:134381476-134381498 TTGGGAGAGCAGAATGAGGAGGG + Intergenic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962520871 3:136196351-136196373 AAGGGAGAGGAAAGGGGGGAGGG - Intronic
962536099 3:136329829-136329851 CAGGCTGAGCAGAAGGTTGAGGG + Intronic
962787776 3:138784408-138784430 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
962838072 3:139206289-139206311 CAGGGAGAGTGGAATGGGGTGGG - Intronic
962862249 3:139414830-139414852 CAGGGTGAGCAGATGGGGAGGGG - Intergenic
962960537 3:140307333-140307355 CAAGGAGAGCAGGAGGAGGCCGG - Intronic
963121167 3:141778240-141778262 CAGGGAAAGCACAAGAGGGCTGG - Exonic
963238770 3:142982272-142982294 GAGGGAGAGGAGAGGAGGGAGGG + Intronic
963249276 3:143087613-143087635 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
963275566 3:143326440-143326462 GAGGGAGAGAAGAGGGAGGAAGG - Intronic
963814473 3:149813780-149813802 CAGGGAAAGAAAAAGGGGGTGGG - Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964654792 3:159054474-159054496 CAGGGAGAGAGGGAGGGGAATGG - Intronic
965173060 3:165293751-165293773 GAGGGAGAGAAGGAGGGAGAAGG + Intergenic
965511024 3:169568065-169568087 GAGGGTGAGCAGAAGCAGGATGG + Intronic
965827568 3:172746120-172746142 CAGGGAGACCAAGAGGAGGAAGG + Intergenic
965961979 3:174440246-174440268 GAGGGAAGGAAGAAGGGGGAAGG - Intronic
966350803 3:179031953-179031975 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350813 3:179031971-179031993 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966350829 3:179032001-179032023 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966954750 3:184864142-184864164 GAGGGGGAGGGGAAGGGGGAAGG + Intronic
966956497 3:184885822-184885844 CAGAGGGAGCAGAAGAAGGAGGG - Intronic
967033667 3:185631508-185631530 TAGGGAGAGAGGGAGGGGGAGGG - Exonic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967341023 3:188398132-188398154 CAGGGAGTGTAGATGAGGGAAGG - Intronic
967407883 3:189137758-189137780 CAGAGACACGAGAAGGGGGAAGG - Intronic
967467637 3:189825930-189825952 GAGAGAGAGAAGGAGGGGGAAGG - Intronic
967529603 3:190533491-190533513 CAGGGGAAGCACAGGGGGGAGGG - Intronic
967715503 3:192757902-192757924 GAGGGAGAGCAGAAGCAGGGTGG + Intronic
967864933 3:194182291-194182313 AAGGAAGAGCAGAAGGAGGAGGG - Intergenic
967897770 3:194413365-194413387 AAGGGAGGGGGGAAGGGGGAGGG - Intronic
967963885 3:194945560-194945582 CAAGGAGAAGAGAGGGGGGAAGG + Intergenic
968080089 3:195839903-195839925 CAGGGAGGGCAGATGAGGGCAGG - Intergenic
968616281 4:1579170-1579192 CAGGGAGGGCAGGGGGGGCAGGG - Intergenic
968755324 4:2412906-2412928 CAGGCAGGGCAGACGGGGGAGGG - Intronic
968889324 4:3359256-3359278 GAGGGAGAGGAGGAGGTGGAGGG - Intronic
968889332 4:3359280-3359302 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
968914484 4:3491356-3491378 CAGGGGGAGCAGAGGAAGGAAGG - Intronic
968977844 4:3831110-3831132 CAGTGAGACCAGGAAGGGGAGGG + Intergenic
969028320 4:4191900-4191922 AAGGGAGAGAGGAAGGGAGAGGG + Intronic
969130156 4:4985173-4985195 CAGGGATGGCAGGATGGGGAGGG + Intergenic
969232671 4:5842538-5842560 CAGGGAGTGTGGAAGGAGGAAGG - Intronic
969293119 4:6253114-6253136 CAGGGAGGAAGGAAGGGGGACGG + Intergenic
969296478 4:6273132-6273154 CAGAGAGAACAGAATGGGGGTGG + Intronic
969352552 4:6606167-6606189 GAGGGAGAGAAGAAGGGAGAGGG + Intronic
969370312 4:6727626-6727648 GAGGGGGAGGAGGAGGGGGAAGG - Intergenic
969414311 4:7048739-7048761 CAGGGACTGGGGAAGGGGGAGGG - Intronic
969436576 4:7192566-7192588 CCGGGAGAGCAGGAGGGCGCTGG - Exonic
969525317 4:7701252-7701274 GAGGGAGGGAAGAAGAGGGAGGG + Intronic
969670262 4:8586236-8586258 GGGGGAAAGCAGCAGGGGGATGG - Intronic
969689109 4:8694554-8694576 CAGGGAGAGCAGGTGGAGGAAGG + Intergenic
969853099 4:9977545-9977567 CAGGGGGAGGGGGAGGGGGAGGG - Intronic
970506730 4:16738384-16738406 CAGGAAGAGGAGGAGGAGGAAGG + Intronic
970522352 4:16898676-16898698 GAGGGAGAGGAGAGGAGGGAGGG + Exonic
970597341 4:17612530-17612552 CAGAGAGAGAAGGAGGAGGAGGG + Intergenic
971218080 4:24680540-24680562 AAGGAAGAGAAGAAGAGGGAAGG + Intergenic
972260945 4:37407878-37407900 GAGGGCGAGCAGAAGCAGGATGG + Intronic
972288102 4:37668210-37668232 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
972551968 4:40142124-40142146 TAGGGAGAGGGGGAGGGGGAGGG + Intronic
972552816 4:40148470-40148492 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
972573472 4:40330998-40331020 CAGGGTGAGCAGCAGGGGAATGG - Intergenic
972990497 4:44817683-44817705 GAGGAAGAGGAGAAGGAGGAAGG + Intergenic
973043875 4:45510657-45510679 AAAGGATAGCAGAAGGGTGAGGG - Intergenic
973076908 4:45940413-45940435 AAGGAAGAAAAGAAGGGGGAAGG + Intergenic
973299060 4:48559630-48559652 GAGGGAGAGAGGAAGAGGGAGGG + Intronic
973675404 4:53256890-53256912 GAGGGAGAGAGGGAGGGGGACGG + Intronic
974508573 4:62807849-62807871 GTGGGAGAGCAGAGGGGGTAGGG + Intergenic
974597692 4:64036628-64036650 AAGGGGGAGGGGAAGGGGGAGGG - Intergenic
974597699 4:64036640-64036662 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
974848482 4:67380188-67380210 GAGGGAGAGGGGGAGGGGGATGG - Intergenic
974918923 4:68212625-68212647 AAGGGAGAGCAGAGGGAGGGAGG + Intergenic
974994780 4:69141373-69141395 GAGGGAGAAAAGAAGAGGGAAGG - Intronic
975205253 4:71638202-71638224 CAGGAAGACCTGAAGTGGGAAGG - Intergenic
975466418 4:74714252-74714274 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
976356267 4:84121025-84121047 CAGGGAGACCACAAGGTAGAAGG + Intergenic
976389714 4:84496357-84496379 GGGGGAGAGGGGAAGGGGGAGGG + Intronic
976607222 4:86995266-86995288 GAGGGAGAGGGGGAGGGGGAAGG - Intronic
977177069 4:93830232-93830254 AAGGGGGAGCAGAAGGTGGGCGG - Exonic
977287029 4:95120785-95120807 GAGGGAGGGGAGCAGGGGGAGGG - Intronic
977367283 4:96086381-96086403 TAGGGTGAGCAGAAAGGGGAGGG + Intergenic
977809754 4:101346183-101346205 CAGGGGGAGGGGGAGGGGGAGGG + Intronic
977990980 4:103442304-103442326 GGGGAAGAGGAGAAGGGGGAAGG - Intergenic
978665653 4:111178101-111178123 AAGGGAGAGGGGAAGGGAGAGGG - Intergenic
978837090 4:113163978-113164000 CATGGGGAGGACAAGGGGGAGGG - Intronic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
979407155 4:120327527-120327549 CAGAGAGAGAGTAAGGGGGAAGG + Intergenic
979559822 4:122089268-122089290 GAGTGAGAGGAAAAGGGGGAGGG - Intergenic
979931191 4:126632961-126632983 AAGGGAGAAAAGAAGGGAGAGGG + Intergenic
980438299 4:132809539-132809561 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
980857709 4:138460008-138460030 TGGGGAGGGGAGAAGGGGGAGGG - Intergenic
980859132 4:138479031-138479053 GGGGGAGGGGAGAAGGGGGAGGG - Intergenic
981269567 4:142829335-142829357 CAGGTAGATCAGAGGGAGGAGGG + Intronic
981956770 4:150484744-150484766 AAGGGAGAGGGTAAGGGGGAGGG - Intronic
982159956 4:152558527-152558549 CAGAGATAGCTGAAGGGAGAAGG - Intergenic
982410989 4:155077126-155077148 CTGAGAGAGAAGAAGGGGAAAGG + Intergenic
982431783 4:155330908-155330930 GAGGGATGGCAGAAGGGTGAGGG + Intergenic
982772384 4:159408797-159408819 ATGGGAGAGCAGGTGGGGGAAGG - Intergenic
982948029 4:161651516-161651538 AAGGAAGAGAAGAAAGGGGAAGG + Intronic
983596390 4:169472430-169472452 GAGGGAGAGCAGAAGCAGGGTGG - Intronic
983941060 4:173534562-173534584 CATGGAGAGATGGAGGGGGAGGG + Intergenic
984237555 4:177179060-177179082 CAGGAAGAGCAGATGGAAGATGG - Intergenic
984703430 4:182833006-182833028 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703447 4:182833055-182833077 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703483 4:182833155-182833177 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703489 4:182833174-182833196 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703505 4:182833227-182833249 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703523 4:182833278-182833300 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703561 4:182833376-182833398 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703567 4:182833395-182833417 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703578 4:182833430-182833452 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703627 4:182833556-182833578 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703633 4:182833575-182833597 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703639 4:182833594-182833616 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703650 4:182833629-182833651 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703699 4:182833755-182833777 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703705 4:182833774-182833796 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703711 4:182833793-182833815 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703724 4:182833832-182833854 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703730 4:182833851-182833873 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703744 4:182833889-182833911 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703755 4:182833924-182833946 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703768 4:182833959-182833981 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703774 4:182833978-182834000 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703780 4:182833997-182834019 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703800 4:182834048-182834070 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703837 4:182834145-182834167 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703843 4:182834164-182834186 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703849 4:182834183-182834205 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703855 4:182834202-182834224 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703866 4:182834237-182834259 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703915 4:182834363-182834385 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703921 4:182834382-182834404 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703927 4:182834401-182834423 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703933 4:182834420-182834442 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703939 4:182834439-182834461 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703952 4:182834478-182834500 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703958 4:182834497-182834519 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703964 4:182834516-182834538 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703970 4:182834535-182834557 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984703976 4:182834554-182834576 AGGGGAGAGGAGAAGGAGGAGGG - Intergenic
984813894 4:183819564-183819586 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
984813904 4:183819588-183819610 GAGGGAGAGTGGGAGGGGGAGGG + Intergenic
984911237 4:184676394-184676416 AAGGGAGAAGGGAAGGGGGAAGG - Intronic
984911249 4:184676425-184676447 AAGGGAGAAGGGAAGGGGGAAGG - Intronic
984944878 4:184963025-184963047 CAGGGAAAACTGAAGGAGGATGG - Intergenic
985487326 5:158763-158785 CAGGAAGAGCAGAGGGAGGAGGG - Intronic
985652281 5:1112560-1112582 GAGGGGGCGCAGAAGGAGGAGGG - Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985669839 5:1201600-1201622 CAGGCAGGGCAGAAGCTGGAGGG - Exonic
985849609 5:2379035-2379057 CAGGGAGAGCTGAATGGAGCAGG + Intergenic
986041871 5:4001376-4001398 CAGGGAGTACAGCTGGGGGAAGG + Intergenic
986044320 5:4022800-4022822 CAGGGAGTCCAGCAGGGAGAAGG - Intergenic
986183625 5:5416971-5416993 GAGGGAGAGGGGAAGGAGGACGG + Intergenic
986635432 5:9817877-9817899 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
986798841 5:11239445-11239467 CTGGGAGAACAGAAGTGGGGAGG - Intronic
987214638 5:15721535-15721557 CAGAGAGAGGAGAAAGGGGAAGG - Intronic
987224957 5:15830788-15830810 AAGGGAGAGAAGATGGTGGAGGG + Intronic
987859370 5:23464727-23464749 GAGGGAGAGGGGAGGGGGGAGGG + Intergenic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
989201743 5:38770626-38770648 CAGGGAGAGCAGAGAAGGGTGGG + Intergenic
989211743 5:38863187-38863209 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
989574865 5:42979817-42979839 CATGGAGAGAGGGAGGGGGAGGG - Intergenic
990013047 5:51023415-51023437 CAGGAAGGCCAGAAGGGAGAAGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990043300 5:51398246-51398268 CAGGGAGCGAAGGAGGGGGAGGG + Intergenic
990297934 5:54421386-54421408 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
990589647 5:57249757-57249779 AGGGGAGAGGGGAAGGGGGAGGG - Intronic
992226714 5:74625852-74625874 AAGGGAGAGCAGACGTTGGAGGG - Intergenic
992442795 5:76811581-76811603 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
992467727 5:77023766-77023788 AAGGGAGAGTAGAAGGGAGGAGG + Intergenic
992578973 5:78151835-78151857 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
992578980 5:78151847-78151869 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
992977832 5:82138865-82138887 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
993043322 5:82839718-82839740 CAGGGAGAGCAGGAGGGAAGTGG + Intergenic
993305639 5:86271877-86271899 GAGCGGGAGCAGAAAGGGGAAGG - Intergenic
993716128 5:91277355-91277377 GAGGAGGAGGAGAAGGGGGAGGG + Intergenic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994355989 5:98794242-98794264 AAGTGAGGGCAGAAGGGTGAGGG - Exonic
994732041 5:103503651-103503673 CAGGAAGAGAAGAAGGGAGTGGG + Intergenic
994744266 5:103659232-103659254 CAGGGAGAGCAGCAACAGGAAGG + Intergenic
995083554 5:108081863-108081885 CGGAGAGAGTAGAAGCGGGAGGG - Intronic
995274203 5:110259629-110259651 CAGGGAGAGCAGATTTAGGATGG + Intergenic
995885328 5:116888152-116888174 AAGGGAGAGCAGCAGGAGGGTGG + Intergenic
996094040 5:119379489-119379511 CAGGCAGGGATGAAGGGGGAAGG + Intronic
996215056 5:120856195-120856217 TAGGGAAGCCAGAAGGGGGATGG - Intergenic
996344173 5:122471810-122471832 CAGGGGGAGTAGAAGGATGAGGG - Intergenic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
996910963 5:128656268-128656290 GAGGGGGAGCAGAAGCAGGATGG - Intronic
997633839 5:135390122-135390144 CAGGGAGAAAAGAAGTGGAAGGG - Intronic
997899814 5:137754228-137754250 AAGGAAGAGAGGAAGGGGGAGGG + Exonic
997981123 5:138467860-138467882 CCGGGAGAGGAGAAGGAGGTGGG - Exonic
998177476 5:139910888-139910910 TGGAGAGAGCAGAAGGTGGAAGG + Intronic
998783491 5:145684104-145684126 GGGGAAGAGCAGGAGGGGGAAGG + Intronic
998929319 5:147163144-147163166 AAGGAAGAGAAGAAGGGGGAAGG - Intergenic
999063728 5:148662457-148662479 GAGTGAGAGGAGAAGAGGGAGGG - Intronic
999323793 5:150630699-150630721 GAGGGAGAGGAGAGGGTGGATGG - Intronic
999435530 5:151560482-151560504 CCGGGAGAGCAAATGGGCGAGGG - Intronic
999440278 5:151595472-151595494 AAGGAGGAGCAGAAGGTGGAAGG + Intergenic
999922356 5:156335652-156335674 CTTGGAGGGCAGGAGGGGGATGG - Intronic
1000052024 5:157571682-157571704 GAGTGAGAGCAGAAGCAGGAAGG + Intronic
1000123066 5:158216432-158216454 CAGGGAGAGGGGCAAGGGGAGGG - Intergenic
1000194858 5:158947487-158947509 GAGGGCGAGCAGAAGCAGGACGG - Intronic
1000294505 5:159901404-159901426 GAAGGGGAGGAGAAGGGGGAGGG + Intergenic
1000329871 5:160198037-160198059 GAAGGAGAGAAGAAGGGGGAAGG + Intronic
1000841053 5:166219072-166219094 CAGGGAGAGAGAAAGGTGGAAGG + Intergenic
1001020522 5:168178631-168178653 CAGGGAGAGGAAAAGAAGGAAGG + Intronic
1001029005 5:168248007-168248029 CATGGAGAGCAGCAGTGGGGAGG + Exonic
1001265484 5:170271172-170271194 CAGAGAGAGAAGAAAGGGGAAGG + Intronic
1001592670 5:172876726-172876748 CAGGGAGAGCGGAAAGGACAGGG - Intronic
1001605181 5:172954601-172954623 GAGGGAGAGAGGAAGAGGGAAGG + Intergenic
1001737797 5:174021047-174021069 AAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1001810941 5:174627772-174627794 CAGGTGGAGCTGAAGTGGGACGG + Intergenic
1002118365 5:176983239-176983261 GAGGGAGAGGAGGAGGGGGAGGG - Intronic
1002400554 5:178989409-178989431 CAGACAGGGAAGAAGGGGGAGGG + Intronic
1002576350 5:180176279-180176301 CAGGCAGAGCAGCCGTGGGAGGG + Intronic
1003052250 6:2790620-2790642 CTGGGAGAGCAGGAGGTGGCCGG + Intergenic
1003550453 6:7098325-7098347 CAGGGAAAGCAGGAGGGGTGAGG - Intergenic
1003812234 6:9796917-9796939 GAGGGAGGGAAGGAGGGGGAAGG + Intronic
1004002050 6:11604821-11604843 AGGGGAGAGGAGGAGGGGGAAGG + Intergenic
1004114029 6:12749541-12749563 GAGGGGGAGGGGAAGGGGGAGGG - Intronic
1004152287 6:13133217-13133239 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1004259258 6:14094191-14094213 CAGGGAGAGCTGCAAGGAGAGGG + Intergenic
1004698564 6:18057248-18057270 CAGGAACAGCAGGAGGGGGATGG - Intergenic
1004746192 6:18511223-18511245 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1004874161 6:19938659-19938681 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1005773319 6:29099934-29099956 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005779369 6:29172408-29172430 GGAGGGGAGCAGAAGGGGGATGG + Intergenic
1005917346 6:30364796-30364818 CAGGGAGACCAGGAGGTGGCAGG + Intergenic
1006199875 6:32279056-32279078 GAGGGTGAGCAGAAGTGGGGTGG + Intergenic
1006210097 6:32386090-32386112 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1006225192 6:32531539-32531561 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1006245085 6:32726444-32726466 GAATGAGGGCAGAAGGGGGAGGG + Intergenic
1006276317 6:33007740-33007762 GAGGGAGAGGAGACTGGGGAGGG + Intronic
1006516058 6:34546363-34546385 CTGGGACAGCAGGAGGGGAAGGG + Intronic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1006972429 6:38060448-38060470 CAGAGAGAGGAGAAAAGGGAGGG - Intronic
1007116956 6:39349557-39349579 CAGGGGGAGCAGTGGGTGGAAGG + Intronic
1007178775 6:39913629-39913651 CAGGGAGAGAAGAGGTGGAAGGG + Intronic
1007228548 6:40331835-40331857 CTTGGGGAGCAGGAGGGGGAGGG - Intergenic
1007267719 6:40609927-40609949 GAAGGGGAGAAGAAGGGGGAAGG - Intergenic
1007292536 6:40798402-40798424 CTGGGAGAGAGGAAGAGGGAGGG + Intergenic
1007345228 6:41223943-41223965 CATGGAGAGGAGAAGAGGAAGGG + Intergenic
1007385545 6:41518067-41518089 CAGGGAGGAAAGAAGGGAGAGGG - Intergenic
1007601269 6:43083186-43083208 TAGGGAGAGCAGGAGGTTGAGGG - Intronic
1007714791 6:43849482-43849504 CAGGGAGAGGAGAAGAAGCAGGG + Intergenic
1007730751 6:43944122-43944144 CATGGAGAGCAGAGAGAGGAAGG - Intergenic
1007744369 6:44034467-44034489 CAGGGAGAGAGGCAGGGGAAGGG + Intergenic
1007759730 6:44127113-44127135 CACGGAGAGCGGAAGGGAGGAGG + Intronic
1007825702 6:44599086-44599108 GAGGGGGAGCTGAAGGGAGAGGG - Intergenic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1007958498 6:45938217-45938239 CACACAGAGCAGAAAGGGGATGG + Intronic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1008016429 6:46525630-46525652 AAGGAAGAGAAGAAGGGGGAGGG + Intergenic
1008068863 6:47079283-47079305 AAGGGAGAGCAGGAAGGAGACGG + Intergenic
1008362338 6:50635548-50635570 AAGGGAGGGGAGAAGGGGAAAGG + Intergenic
1008378878 6:50820873-50820895 GAGGGAGAGAGGAAGAGGGAGGG + Intronic
1008407676 6:51136734-51136756 GAGGGTGAGCAGAAGGAGGGTGG - Intergenic
1008534922 6:52500398-52500420 CAGGGAGGGTGGCAGGGGGAGGG + Exonic
1008862981 6:56173376-56173398 AAGGGAAAGGAGAAGGGGAAGGG + Intronic
1009305982 6:62089522-62089544 GAGGGCGAGCAGAAGGAGGGTGG - Intronic
1009452386 6:63817256-63817278 AAGGGAGAGCAAACAGGGGATGG + Intronic
1009767560 6:68100875-68100897 GAGGGAGAGAGGAAGGGAGATGG - Intergenic
1009826691 6:68875214-68875236 GAGGGGGAGAGGAAGGGGGAAGG - Intronic
1009844940 6:69122462-69122484 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1010400782 6:75442754-75442776 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1010700089 6:79033934-79033956 CAAGGAGAGAAAAATGGGGAAGG + Intronic
1011146063 6:84218203-84218225 CAGGGAGACCAGAACAGGCAGGG + Intronic
1011476296 6:87752110-87752132 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1011484757 6:87830004-87830026 AAGGGAGAGGAGAAGGAGGAAGG - Intergenic
1011965968 6:93157503-93157525 CGGGGAGGGAAGAAGGGGGTTGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1013075594 6:106768296-106768318 CAAGAAGAGCAGAAGAGGGAAGG + Intergenic
1013192961 6:107819345-107819367 CAGGGAGAGGAAAAGGGCAAGGG + Intronic
1013273161 6:108560789-108560811 CGGGGCGGGGAGAAGGGGGAGGG - Intronic
1013311240 6:108895834-108895856 GAGGGAGAGGAGGAGGGGAATGG + Intronic
1013539628 6:111095144-111095166 AAGGGAGAGAAGCAGGGGCAAGG - Intronic
1013608599 6:111773566-111773588 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1013652509 6:112209999-112210021 GAGGGAGAGCACAAAGGGGGAGG - Intronic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1015382876 6:132589459-132589481 CAGGGAGAGCAGCAGGAAGTTGG + Exonic
1015485439 6:133764609-133764631 GAGGGAGAGAGGGAGGGGGAAGG + Intergenic
1015544562 6:134348140-134348162 GAGGGAGAGCAGAGGCGGGCTGG + Intergenic
1015626163 6:135182293-135182315 GAGGGAGAGGAGGAGGAGGAGGG + Intronic
1016021002 6:139236046-139236068 TGGGGAGGCCAGAAGGGGGAAGG - Intergenic
1016166659 6:140953774-140953796 GAGAGAGAGCACAAGGGGGGAGG - Intergenic
1016307897 6:142702665-142702687 TAGGGAGAGCAGCTGGGGGAGGG - Intergenic
1016749178 6:147613732-147613754 GAGGAAGAGCAGAAGGGGGAAGG + Intronic
1017013341 6:150080008-150080030 CTTGGAGGGCAGATGGGGGAAGG - Intergenic
1017063315 6:150506963-150506985 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1017103482 6:150867062-150867084 ATGGGAGAGCAGAGGGAGGAAGG - Intronic
1017494027 6:154967406-154967428 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1017637428 6:156456324-156456346 GAGGAAGGGGAGAAGGGGGAGGG - Intergenic
1017851711 6:158309908-158309930 GAGGGAGAGGGGGAGGGGGAGGG + Intronic
1017981741 6:159406746-159406768 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1018088580 6:160326052-160326074 CAGGGAGAGGAGAGGTGGCAAGG - Intergenic
1019064672 6:169287216-169287238 GAGGGACAGCAGAGGGGAGAGGG + Intergenic
1019289272 7:242438-242460 CTGAGAAAGCAGAAGGAGGAGGG + Intronic
1019410780 7:905733-905755 AAGGGAAAGGAGAAGGGAGAAGG + Intronic
1019531670 7:1506530-1506552 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1019549245 7:1594006-1594028 GAGGGAAAGAAGAAGGAGGAGGG - Intergenic
1019668830 7:2267318-2267340 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1019715196 7:2535315-2535337 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1020011490 7:4808002-4808024 GAGGGAGAGGAGAGGGAGGAGGG - Intronic
1020451331 7:8323486-8323508 GGGGGAGAGCTGAAGGGAGATGG + Intergenic
1020594985 7:10195277-10195299 CAGGGAGACCATTAGTGGGAGGG - Intergenic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021698255 7:23294061-23294083 CAGGGAGAGCAGCCTGGGGTGGG - Intergenic
1021972223 7:25976649-25976671 CAGGCAGGGCAAAAGGGGAAGGG + Intergenic
1022038013 7:26552253-26552275 GAGGGAGTGCAGAGGAGGGATGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022187693 7:27986635-27986657 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1022717888 7:32915195-32915217 CAGCCAGAGCAAAAGAGGGAGGG + Intergenic
1023003735 7:35840173-35840195 AAGGGGGAGGAGGAGGGGGAGGG - Intronic
1023046550 7:36215197-36215219 CAGGGAGGGCAGCAGCGGGTGGG - Intronic
1023057978 7:36304858-36304880 AAGGGAGAGAGGAAGGGGGAGGG + Intergenic
1023156440 7:37256709-37256731 AAGGGAGAGGGGCAGGGGGAAGG + Intronic
1023169195 7:37374254-37374276 CAGGGAGAGAAGGAGAGGGGAGG + Intronic
1023371746 7:39518842-39518864 AAGGGAGAGAAGAAGGCGGTGGG - Intergenic
1023824645 7:44000875-44000897 GAGAGAGAGAAGAATGGGGAGGG + Exonic
1024048335 7:45600402-45600424 CAGGGAGAGCAGCCATGGGAAGG + Intronic
1024109783 7:46133618-46133640 GAGGGAGAGAAGGAGGAGGAGGG - Intergenic
1024196418 7:47063872-47063894 GAGGGAGAGGAGGAGGGGGAGGG - Intergenic
1024196465 7:47064036-47064058 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1024290955 7:47803639-47803661 CAGGGAGAACAGACGTGGGGTGG - Intronic
1024312155 7:47979375-47979397 CAGGAGGATCAGAACGGGGATGG - Intronic
1024725479 7:52189404-52189426 GAGGGGGAGGAGAAGGGAGAGGG + Intergenic
1024809531 7:53191550-53191572 CAGCAAGAGCAGAAGTGAGAGGG + Intergenic
1024994276 7:55260271-55260293 GAGGAAGAGCAGAAGGGGCGAGG + Intergenic
1025852658 7:65257386-65257408 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1026088194 7:67279627-67279649 GAGAGAGAGAAGAATGGGGAGGG + Intergenic
1026114695 7:67486394-67486416 AAGACAGAGCAGAAGGGGAATGG - Intergenic
1026162651 7:67883276-67883298 GAGGGAGAGAAGGAGGGAGACGG - Intergenic
1026206297 7:68260709-68260731 AAGGGAAAGAAGAAGGAGGATGG - Intergenic
1026238023 7:68545754-68545776 GAGGGAGAGAAGGAGGGGGAGGG - Intergenic
1026678351 7:72446940-72446962 GAGGAAAAGCAGAAGGGGGAAGG + Intronic
1026726050 7:72870639-72870661 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1026742250 7:72986186-72986208 CAGGAAAGGCAGATGGGGGAGGG - Intergenic
1026762540 7:73137707-73137729 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1026802098 7:73406606-73406628 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1026848176 7:73709207-73709229 CAGGGAGAGGGGGAGGGGCAGGG - Intronic
1026928435 7:74209886-74209908 AAGGGAGGGGAGACGGGGGAAGG - Exonic
1027028374 7:74870925-74870947 CAGGAAAGGCAGATGGGGGAAGG - Intergenic
1027039003 7:74947483-74947505 GAGGGGGAGGGGAAGGGGGAGGG + Intergenic
1027084684 7:75254993-75255015 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1027101485 7:75378892-75378914 CAGGAAAGGCAGATGGGGGAGGG + Intergenic
1027117793 7:75494965-75494987 GAGAGAGAGAAGAATGGGGAGGG + Intergenic
1027274012 7:76540515-76540537 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1027319434 7:77002826-77002848 CAGGGAGAGCAGCTGGGGGTCGG - Intergenic
1027327456 7:77059567-77059589 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1027464918 7:78503560-78503582 GAGGGGGAGGAGGAGGGGGAGGG - Intronic
1027721228 7:81744026-81744048 AAGTGAGAGCAGAAGGGATATGG - Intronic
1027753805 7:82185477-82185499 GAGGGGGAGGAGGAGGGGGAGGG + Intronic
1027980035 7:85206238-85206260 CATGGAGAATAGAAGGGAGAAGG - Intergenic
1028433512 7:90775627-90775649 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028433519 7:90775639-90775661 AAGGGGGAGGGGAAGGGGGAGGG - Intronic
1028468708 7:91181204-91181226 AAGGGAGAGAAAAAGGGAGACGG - Intronic
1028715645 7:93964275-93964297 CAGGCACTGTAGAAGGGGGAAGG - Intronic
1029064872 7:97839315-97839337 CAGGGGGAGCAGAGGAGGGCCGG + Intergenic
1029194875 7:98798249-98798271 CAGGAAGAGCAGGAGAGAGAAGG + Intergenic
1029309641 7:99650730-99650752 GAGGCAGAGGAGAAGGTGGACGG - Intronic
1029355468 7:100048530-100048552 CATGGATGGCAGGAGGGGGATGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029463518 7:100710672-100710694 CAGGCAGAAAAGAAGGGAGATGG + Intergenic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029620612 7:101688082-101688104 CTGGGAGTGCAGCAGGGGGGTGG - Intergenic
1029719705 7:102355090-102355112 GAGAGAGAGAAGAATGGGGAGGG - Intergenic
1029752908 7:102554168-102554190 GAGAGAGAGAAGAATGGGGAGGG + Intronic
1029770860 7:102653260-102653282 GAGAGAGAGAAGAATGGGGAGGG + Intronic
1029795852 7:102893818-102893840 GAGGGGGAGAAGAAGGGGAAGGG + Intronic
1030073696 7:105719215-105719237 GAAGAAGAGAAGAAGGGGGATGG - Intronic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1030735550 7:113043558-113043580 CAAGGAGAGCACAAGGGGGAAGG + Intergenic
1030783083 7:113625755-113625777 AGGGGAGGGGAGAAGGGGGAAGG - Intergenic
1031327545 7:120420604-120420626 CGGGGTGAGGAGTAGGGGGAAGG + Intronic
1031595080 7:123640672-123640694 GAGGGGGAGGAGGAGGGGGAGGG + Intergenic
1031595105 7:123640717-123640739 GAGGGGGAGGAGAAGGGGAAGGG + Intergenic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1032034048 7:128508575-128508597 AAGGGTGAGCAGAATGGCGAGGG + Intergenic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032092904 7:128920579-128920601 CAGGCAGAGCAGAAGGAGGTCGG - Intergenic
1032129313 7:129215728-129215750 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1032619115 7:133509521-133509543 CAGGGAGAGAGGAAGAGGAAGGG - Intronic
1032929977 7:136655023-136655045 AGGGGAGAGCAGAAGAGGGGTGG + Intergenic
1033124796 7:138698158-138698180 GAGGGAAAGAAGGAGGGGGAAGG + Intronic
1033308157 7:140239766-140239788 GAGGGAGAGAAGGAGGGGGCGGG + Intergenic
1033323581 7:140361523-140361545 GAGGGAGAGAGGGAGGGGGAGGG - Intronic
1033525351 7:142207949-142207971 TAGGGAGAGAAGAATGGTGAAGG + Intronic
1033565518 7:142574893-142574915 CAGGGGGAGGGGGAGGGGGAGGG - Intergenic
1033606650 7:142932638-142932660 CAGGAAGAGCAGCTGGGGCAGGG - Intronic
1033798505 7:144874884-144874906 GAGGGAGAGGGGAAGAGGGAGGG - Intergenic
1033804392 7:144937599-144937621 AAGGGGAAGCAGAAAGGGGAAGG - Intergenic
1033890439 7:146006416-146006438 CAGGGGGAGGAGAAGGAGCAGGG - Intergenic
1033956389 7:146854054-146854076 CAGGGAGATGAGAAGGAGGCTGG + Intronic
1033969772 7:147025325-147025347 CAGGGAGAAGAAAGGGGGGAGGG + Intronic
1033969813 7:147025405-147025427 AAGGGGGAGGGGAAGGGGGAGGG + Intronic
1033970620 7:147034691-147034713 TGGGGAGGTCAGAAGGGGGATGG + Intronic
1034280526 7:149850808-149850830 CAGGTGGATCAGAAGGAGGAAGG + Intronic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1034752373 7:153582873-153582895 TGGGGAGGGCAGAATGGGGATGG + Intergenic
1034763596 7:153696467-153696489 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1035057810 7:156047945-156047967 CACGGACAGCAGGAGGGGAAAGG + Intergenic
1035172314 7:157024154-157024176 CAGGGGGAGCGGGAGGGGAATGG - Intergenic
1035237614 7:157509017-157509039 CAGGGAGAGCGAAGGGGAGAGGG + Intergenic
1035303263 7:157911851-157911873 CAGGGTTAGCAGAAGACGGAAGG - Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035579761 8:732106-732128 CAGGGAGACAAGAAGGGGTCTGG - Intronic
1035717767 8:1766897-1766919 CAGGCAGCACAGAAGGGGTATGG - Intronic
1035760449 8:2064783-2064805 CCAGGAGAGGAGAAGGAGGAGGG - Intronic
1035844871 8:2852484-2852506 CGAGGACAGCAGCAGGGGGAGGG - Intergenic
1035981493 8:4377274-4377296 CAGAGAGAGCAAAAGGGAGGAGG + Intronic
1036295213 8:7529236-7529258 AAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1036327357 8:7791782-7791804 AAGGAGGAGGAGAAGGGGGAGGG + Intergenic
1036390961 8:8324085-8324107 CAGGGCAAGCACAATGGGGAAGG + Intronic
1036405458 8:8450896-8450918 ATGGGAGATGAGAAGGGGGAGGG + Intergenic
1036424226 8:8628487-8628509 CAGGGAGGGCAGAAGGAAAATGG - Intergenic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1036665402 8:10734083-10734105 GAGGGGGAGAAGGAGGGGGAGGG + Intronic
1036723431 8:11200034-11200056 CTGGGAGTGCAGGAGGGGGAAGG + Intronic
1037561416 8:20078143-20078165 GAAGGAGGGCAGAAAGGGGAAGG - Intergenic
1037586556 8:20280679-20280701 CAGGGAGGGAGGAAGGGGCAGGG + Intronic
1037917452 8:22781289-22781311 CCGGGAGAGCCGGAGGGGGAAGG + Intronic
1038007394 8:23444366-23444388 GATGGAGAGGAGAAGGAGGAAGG + Intronic
1038499164 8:28029186-28029208 AAGCGAGTGCAGAAGGTGGAAGG - Intronic
1038522167 8:28243125-28243147 CATGGAGAGGAGTTGGGGGAGGG - Intergenic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038711087 8:29946437-29946459 TAGGGAGAGGAGAAGGAGGGAGG - Intergenic
1038927232 8:32154269-32154291 GGGGGAGAGCAAAAGGGGAAGGG - Intronic
1039588658 8:38728607-38728629 CAGGTGGCGCAGAAGGGAGAGGG + Intronic
1039905857 8:41785958-41785980 CAGGGAGAAGAGACGCGGGAGGG - Intronic
1039951370 8:42175447-42175469 CAGGGAGTGGGGAAAGGGGAAGG + Exonic
1040079752 8:43274856-43274878 GAGGAAGAGGAGGAGGGGGAGGG - Intergenic
1040416001 8:47196685-47196707 GCTGGAGAGCAGTAGGGGGATGG - Intergenic
1041011445 8:53547598-53547620 GAGGGGAAGCAGAAGGGGAAAGG + Intergenic
1041401366 8:57448750-57448772 GAGGGGGAGGAGAAGGAGGAGGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041696518 8:60742206-60742228 CATGGAGAGCAGTAGAGGGGTGG - Exonic
1042040807 8:64586620-64586642 CATGGAAAGCAGGAGTGGGAGGG + Intergenic
1042865013 8:73349388-73349410 CAGGGAGAGAAGCAGGGTGGTGG - Intergenic
1043065877 8:75569252-75569274 CAGGAAGACTAGAAGGGGAAAGG - Intergenic
1044422933 8:92019406-92019428 AAGGAAGAGCAGGAGGGGGAGGG + Intronic
1044597376 8:93971424-93971446 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1044647986 8:94464890-94464912 GAGGGAGAGCAAAAGAGGGAGGG + Intronic
1045127123 8:99104556-99104578 AAGGGAGAGGGGAGGGGGGACGG - Intronic
1045193726 8:99908760-99908782 CAGAGAGAAGAGAAGGAGGAGGG + Intergenic
1045474635 8:102542557-102542579 GAGGGGGAAGAGAAGGGGGAAGG - Intergenic
1046015610 8:108601144-108601166 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1046334416 8:112765998-112766020 AAGTGAGAGCAGTATGGGGAAGG - Intronic
1046525712 8:115379995-115380017 GAGAGAGAGAAGAAGGAGGAAGG + Intergenic
1046625464 8:116572311-116572333 GATGAAGAGAAGAAGGGGGAGGG - Intergenic
1046776010 8:118164114-118164136 GAGGGAGAGCAGCAGGAGGAAGG + Intergenic
1046859100 8:119070477-119070499 GAGGGAGGGAAGGAGGGGGAAGG - Intronic
1046859916 8:119079096-119079118 AAGGAAGAGGACAAGGGGGAAGG - Intronic
1047164419 8:122421200-122421222 CAGGGAGGACAGAGGGGGGAAGG + Intergenic
1047218187 8:122896163-122896185 CAGGGAGAACAGAAGAGCAATGG - Intronic
1047254792 8:123207020-123207042 GAGGGAGAGGGGAAGTGGGAGGG - Intronic
1047309920 8:123683391-123683413 AAGGGGGAGGTGAAGGGGGAGGG - Intronic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1047597317 8:126392072-126392094 GAGGGAGAGAGGAAGGGAGAGGG + Intergenic
1047624779 8:126645507-126645529 CAGGAAGAGCAGGAGAGGGAGGG - Intergenic
1047782687 8:128123026-128123048 CAGGGAGAGAGGGAGGAGGAAGG - Intergenic
1047992829 8:130304508-130304530 CAGGGAGTGCAGATGCGTGAAGG - Intronic
1048054745 8:130852743-130852765 CATGGGGTGCAGAAGGGTGAGGG - Intronic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048321418 8:133403587-133403609 CAGGGAGAAGTGAAAGGGGAGGG + Intergenic
1048447713 8:134504438-134504460 CAGGGAAAGAAGAAAGGGCACGG + Intronic
1048884161 8:138895713-138895735 CAGGGAGAGAAGAAAGAGTACGG + Intronic
1049311588 8:141936529-141936551 CCAGCAGAGCAGCAGGGGGAAGG - Intergenic
1049365188 8:142233659-142233681 GAGGCAGAGCAGACAGGGGAGGG - Intronic
1049428783 8:142549698-142549720 CTGGGAGTGCATAAGTGGGAGGG + Intergenic
1049538082 8:143191780-143191802 CAGGGAGTGCAGGAAGGGGTGGG + Intergenic
1049777272 8:144412562-144412584 CAGGGACAGCAGCAGCAGGACGG + Exonic
1049949169 9:627699-627721 CAGGGGGACCAGAGGGTGGATGG + Intronic
1050048939 9:1577514-1577536 CAGGGAGGCAAGAAAGGGGAGGG + Intergenic
1050723083 9:8613305-8613327 AAGAGAGAGCAGGAAGGGGAAGG + Intronic
1050885676 9:10762182-10762204 GAGGGAGAGAGGGAGGGGGAGGG + Intergenic
1051106639 9:13587893-13587915 CAAGGAGACCAGAAGTGGGATGG - Intergenic
1051352048 9:16206104-16206126 AAGGGAGAGCAGAGGTGGGTGGG + Intronic
1051658196 9:19402708-19402730 CAGGCAGAGCACTGGGGGGAGGG - Intergenic
1051738152 9:20224680-20224702 AAGGCAGAGAAGAAGAGGGAGGG + Intergenic
1052008533 9:23379528-23379550 CAGTGAGATAACAAGGGGGAGGG - Intergenic
1052112741 9:24608956-24608978 AAGGGAGGGTAGAAGGGGGAGGG - Intergenic
1053014482 9:34654202-34654224 AAGGGGGAGCAGAAGGAGGAAGG - Intronic
1053064905 9:35061253-35061275 CAGGGATAGCAGTCAGGGGAAGG - Intronic
1053263860 9:36696078-36696100 CAGGGACAGGAGAAGGGGTGAGG - Intergenic
1053441621 9:38120958-38120980 GAGGGGGAGGAGAAGGAGGAGGG + Intergenic
1053484748 9:38443259-38443281 CTGGGAGAGGAGAAGTGGGAGGG + Intergenic
1054359523 9:64100260-64100282 GAGGGAGAGGAGGAGGGAGAGGG - Intergenic
1054901150 9:70370761-70370783 GAGGGGGAGAGGAAGGGGGAGGG + Intergenic
1054907139 9:70421172-70421194 CAGGAGGAGAGGAAGGGGGAGGG - Intergenic
1055197772 9:73617597-73617619 TAGGGAGAGGAAAAGGGAGAAGG - Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055371227 9:75601764-75601786 CAGGGAGAGAGGAATGGGGAAGG + Intergenic
1055823970 9:80301562-80301584 GAGGGCGAGCAGAAGCAGGATGG - Intergenic
1056097634 9:83272068-83272090 GAGGGAGAGGGGGAGGGGGAGGG - Intronic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056395819 9:86180277-86180299 CAGGGAAAGCAAGATGGGGAAGG - Intergenic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1057079528 9:92162217-92162239 CTGGAAGAGAAGAAGGGAGAGGG + Intergenic
1057167624 9:92941139-92941161 GAGGGAAAACAGCAGGGGGAAGG + Intergenic
1057194294 9:93108202-93108224 GAGGGAGAGCCGAAGTGGGATGG + Intronic
1057353790 9:94319593-94319615 CAGGTAGAGCAGCGGAGGGAGGG - Exonic
1057420167 9:94905869-94905891 CAGGGAGTGCAGAAGGGGCTGGG + Intronic
1057439024 9:95068813-95068835 CACTGAGAAGAGAAGGGGGAGGG + Intronic
1057653960 9:96937999-96938021 CAGGTAGAGCAGCAGAGGGAGGG + Exonic
1057716364 9:97498918-97498940 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1057729240 9:97594489-97594511 CAGGGAGCGCAGATTGGGAAGGG + Intronic
1058102542 9:100933264-100933286 CGGGGAGGGAAGAAGGGGGCAGG - Intergenic
1058368473 9:104236074-104236096 GAGGGAGAGAGGGAGGGGGAGGG + Intergenic
1058368485 9:104236102-104236124 GAGGGAGAGGTGGAGGGGGAGGG + Intergenic
1058375292 9:104316052-104316074 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1059228521 9:112695766-112695788 AAGGGAGAGGAGGAGGGGGAGGG + Intronic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059655533 9:116354226-116354248 AAGGAAGAGCAGAAGGAGCAAGG + Intronic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059931088 9:119261872-119261894 GAGGAAGAGAAGAAGGAGGAGGG - Intronic
1060168751 9:121443194-121443216 CAGGCAGAGGAGTAGGTGGAAGG - Intergenic
1060397526 9:123326596-123326618 CAGGGAGAGGAGAGGTGGGGAGG - Intergenic
1060755084 9:126206679-126206701 CAGGGAGAGCAAGAGAAGGAAGG - Intergenic
1060777196 9:126383682-126383704 AAGAGAGAACAGATGGGGGAGGG + Intronic
1060859877 9:126945615-126945637 CAAGTACAGCAGAAAGGGGAAGG - Intronic
1060900949 9:127257742-127257764 CAGGGAGAAGAGAAAGGGAAAGG + Intronic
1060953684 9:127622158-127622180 GGGGGAGGGCAGAATGGGGAGGG + Intronic
1061133438 9:128720789-128720811 GAGGGCGAGCTGGAGGGGGAAGG - Exonic
1061178710 9:129011906-129011928 CAGAGACAGCAGGAGGTGGAGGG + Intronic
1061200654 9:129136657-129136679 GAGGGAGCGCAGGAGGGGCAGGG - Intronic
1061246054 9:129401761-129401783 GAGGGAGATAAGGAGGGGGAGGG - Intergenic
1061246094 9:129401869-129401891 CAGGGAGAGCAGAGCTGTGAAGG - Intergenic
1061246940 9:129405401-129405423 CGGGGGGAACAAAAGGGGGACGG + Intergenic
1061250198 9:129421950-129421972 CAGGGAGAGCAGTGGGGACAAGG - Intergenic
1061287251 9:129631108-129631130 CAGGGAGTGCTGGAGGGGGTGGG - Intronic
1061361288 9:130143961-130143983 CAGAGAGCTCTGAAGGGGGACGG - Intergenic
1061473179 9:130843709-130843731 CAGGAAGAGCAGAAGAGGCTGGG + Intronic
1061598281 9:131646936-131646958 CTGGAAGAGCTGAAGGGGAAAGG + Intronic
1061934966 9:133852388-133852410 AAGGCAGAGCAGAAGGGTGGGGG + Intronic
1061940872 9:133883096-133883118 CAGAGAGAGCAGCAGGGGGTGGG - Intronic
1062174459 9:135153279-135153301 CAGGGACAGCAAACGTGGGAAGG - Intergenic
1062271889 9:135713651-135713673 GCAGGAGAGCAGAGGGGGGATGG - Intronic
1062449137 9:136608255-136608277 GAAGGAGAGGAGAAGGGGGAAGG + Intergenic
1062449151 9:136608288-136608310 AAGGGAGGGAGGAAGGGGGAAGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1062469733 9:136697064-136697086 GAGGGGGAGGAGGAGGGGGAGGG - Intergenic
1062513257 9:136919654-136919676 GAGGGAAAGAAGGAGGGGGAGGG - Intronic
1062596186 9:137300813-137300835 CGGGGAGAAGGGAAGGGGGAGGG + Exonic
1062722346 9:138050971-138050993 CAGGAAGAGCACAGGGGGCAGGG + Intronic
1062731358 9:138111888-138111910 CAAGGAGAGCAGAGCGGGGAAGG - Intronic
1185459548 X:328353-328375 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459565 X:328381-328403 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459576 X:328401-328423 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459587 X:328421-328443 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459638 X:328525-328547 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459655 X:328553-328575 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459666 X:328573-328595 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459677 X:328593-328615 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459708 X:328655-328677 CGGGGAGAGGGGAGGGGGGACGG - Intergenic
1185459725 X:328683-328705 CGGGGAGAGGGGAGGGGGGATGG - Intergenic
1185459783 X:328779-328801 CAGGGAGAGGGGAGGGGGGCGGG - Intergenic
1185459922 X:329063-329085 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185459931 X:329083-329105 CGGGGAGAGAGGAGGGGGGACGG - Intergenic
1185499129 X:584275-584297 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1185499157 X:584375-584397 GAGGGAGAGGAGGAGGGGAAGGG + Intergenic
1185581203 X:1212899-1212921 GAGGGGGAGGAGATGGGGGAGGG - Intergenic
1185708460 X:2282618-2282640 GAGGGAGAGAAGAAGGGAAAGGG + Intronic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186269185 X:7866466-7866488 AAGGGAGAGAGGAAGGGGGCAGG - Intergenic
1186490686 X:9970118-9970140 GAGGGAGAGAGGGAGGGGGAGGG - Intergenic
1186604559 X:11076949-11076971 CAGGAAGAGTAGATGGGGGTGGG - Intergenic
1186689708 X:11962329-11962351 CAGGAAGAGCAGAAGGGAAAAGG + Intergenic
1187289564 X:17940068-17940090 CAGTGAGAGCAGAAGCAGGAGGG - Intergenic
1187426480 X:19181830-19181852 CTGAAAGAGCAGAAGGGAGATGG + Intergenic
1187505367 X:19874680-19874702 AAGGGAGAGCAGAAGTGGGGAGG + Intronic
1187668397 X:21641902-21641924 GTGGGAGAACAGAAGGGGAAAGG + Intronic
1188050415 X:25478536-25478558 GAGGGAGAGCAAGAGGAGGAAGG - Intergenic
1188388375 X:29590149-29590171 CAAGGACAGCAGCAAGGGGATGG + Intronic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189720537 X:43911406-43911428 CAAGAAGAGCAGCAAGGGGATGG - Intergenic
1189908995 X:45790558-45790580 TAGAGAGAGCACAAAGGGGAAGG + Intergenic
1189988875 X:46576190-46576212 AAGGGAGAGGAGGAGGGGAAGGG - Intronic
1190220349 X:48508909-48508931 ATGGGAGAGCAGGAGGGGGGCGG - Intergenic
1190274108 X:48889420-48889442 CAGGAGGAGCAAAAGGGAGACGG - Intergenic
1190439496 X:50463276-50463298 GAGGGAGAGAGGAAGGAGGATGG - Intronic
1190469988 X:50769205-50769227 GAGGGAGGGAAGAAAGGGGAAGG + Intronic
1190505448 X:51120485-51120507 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1190881320 X:54494876-54494898 CAGACAGAGGAGAAGGGGGTTGG + Intronic
1191108293 X:56786031-56786053 GAGAGAGGGCAGAAAGGGGAGGG - Intergenic
1191112152 X:56812370-56812392 TAGGGAGGGCAGAAAGAGGAGGG - Intergenic
1191836655 X:65470386-65470408 AAGGGAGAGGAGATGGGGGCTGG + Intronic
1191842875 X:65525469-65525491 CAGGGAGAAGAGAAGGGGTAGGG - Intronic
1191850572 X:65582930-65582952 AAGGGAGAGCAGGAGGGGGAGGG + Intergenic
1192033966 X:67544373-67544395 GCGGGAGAGAAGACGGGGGAGGG - Intronic
1192079384 X:68032657-68032679 CAGTGACAGCAGCAGGGGAAGGG - Intergenic
1192322743 X:70105264-70105286 CAGGGAGGGCTGGAAGGGGAGGG - Intergenic
1192343271 X:70281300-70281322 CAACAAGAGCAGAAGGTGGAGGG - Intronic
1192464266 X:71342560-71342582 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1192500335 X:71645916-71645938 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1192733652 X:73827112-73827134 CAAGTAGGGCAGAAGGTGGAAGG - Intergenic
1193043882 X:77032069-77032091 GAGGGTGAGCAGAAGCAGGATGG - Intergenic
1193328314 X:80207625-80207647 CAGGGAGAGAACAAGGAGGTGGG - Intergenic
1193394396 X:80967449-80967471 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1193836339 X:86349181-86349203 TGGGGAGGCCAGAAGGGGGATGG + Intronic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1193871121 X:86799533-86799555 GAGGGAGAGCTGAAGCAGGATGG + Intronic
1194765415 X:97842661-97842683 GTGGCAGAGCAGAAGCGGGAGGG - Intergenic
1194859560 X:98980032-98980054 TGGGGAGGCCAGAAGGGGGATGG - Intergenic
1195299106 X:103509548-103509570 GAGGGAGAGGAAGAGGGGGATGG - Intronic
1195649146 X:107266508-107266530 CAGGAAAAGTAGTAGGGGGAGGG - Intergenic
1196181102 X:112690491-112690513 GAGGAAGAGAAGAAGGAGGAGGG + Intergenic
1196237581 X:113300064-113300086 CAGAGAGAGGAGGAGGGGAAGGG - Intergenic
1196895840 X:120334721-120334743 CAGTAGGAGCAGAATGGGGAAGG - Intergenic
1197184665 X:123573356-123573378 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1197718083 X:129724584-129724606 AAGGGAGAGCAGAGGAAGGAGGG + Intergenic
1197765477 X:130057073-130057095 CAGGGAGGCCAGAACGGGGTGGG - Exonic
1197771511 X:130092349-130092371 CAGGGAGTGCAGAGAGGGAAGGG + Intronic
1197967925 X:132084826-132084848 CAGGGAGATCACAAGAGGAAAGG + Intronic
1198108806 X:133484644-133484666 GAGGGAGAGGGGGAGGGGGAGGG + Intergenic
1198567153 X:137916383-137916405 CAGGCAGGGCAGTGGGGGGATGG + Intergenic
1198600964 X:138283437-138283459 CGGGGAGAGGGGGAGGGGGAGGG + Intergenic
1198645577 X:138802388-138802410 AAGGGTGAGCAGAAGCAGGATGG - Intronic
1198886220 X:141341498-141341520 CAGAGATAGCAGAAGGGAAATGG - Intergenic
1198890336 X:141387828-141387850 CAGGGGGAGTTGAAGGAGGAGGG - Intergenic
1199908331 X:152259009-152259031 CAGTGACAGCAGATTGGGGAGGG - Intronic
1200215607 X:154366906-154366928 CAGGGAGGGCTGAAGGGTGGAGG - Intronic
1200363021 X:155631084-155631106 CAGGGAGAGAAGGAGGGGTGAGG - Intronic
1201300269 Y:12498827-12498849 GAGGAGGAGGAGAAGGGGGAGGG - Intergenic
1201335622 Y:12878103-12878125 GAGGGAGAGGGGCAGGGGGAGGG - Intergenic
1201498739 Y:14618362-14618384 GAGGGTGAGCAGAAGTAGGATGG - Intronic
1201590552 Y:15610496-15610518 GAGGGTGAGCAGAAGCAGGATGG + Intergenic
1201948143 Y:19535185-19535207 GAGGGGGAGGGGAAGGGGGAGGG - Intergenic
1201948150 Y:19535197-19535219 GAGGGAGAGGGGGAGGGGGAGGG - Intergenic
1202270966 Y:23073652-23073674 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202295060 Y:23347030-23347052 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202379261 Y:24261494-24261516 GAGGGGCAGCAGAAGGGTGAAGG - Intergenic
1202423961 Y:24707396-24707418 CAGAAAGGGAAGAAGGGGGATGG + Intergenic
1202446828 Y:24962689-24962711 CAGAAAGGGAAGAAGGGGGATGG - Intergenic
1202491521 Y:25408627-25408649 GAGGGGCAGCAGAAGGGTGAAGG + Intergenic