ID: 996700040

View in Genome Browser
Species Human (GRCh38)
Location 5:126441574-126441596
Sequence CTAAATAAAGAGAAGGAATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 723
Summary {0: 1, 1: 0, 2: 5, 3: 76, 4: 641}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996700040_996700045 2 Left 996700040 5:126441574-126441596 CCATATTCCTTCTCTTTATTTAG 0: 1
1: 0
2: 5
3: 76
4: 641
Right 996700045 5:126441599-126441621 CATTTGATCATGCCATACAAGGG 0: 1
1: 0
2: 0
3: 6
4: 106
996700040_996700047 25 Left 996700040 5:126441574-126441596 CCATATTCCTTCTCTTTATTTAG 0: 1
1: 0
2: 5
3: 76
4: 641
Right 996700047 5:126441622-126441644 AGAACTATAAATAATAATGCTGG 0: 1
1: 0
2: 1
3: 49
4: 457
996700040_996700044 1 Left 996700040 5:126441574-126441596 CCATATTCCTTCTCTTTATTTAG 0: 1
1: 0
2: 5
3: 76
4: 641
Right 996700044 5:126441598-126441620 CCATTTGATCATGCCATACAAGG 0: 1
1: 0
2: 0
3: 4
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996700040 Original CRISPR CTAAATAAAGAGAAGGAATA TGG (reversed) Intronic
900762826 1:4484221-4484243 TTAAAGAAGGAGAAGGAAAAGGG - Intergenic
901264852 1:7902728-7902750 CTAATTAAAGGGAAGGAAATAGG - Intergenic
901450532 1:9333928-9333950 CAAAAAAATGAGAAGGAATGTGG - Intronic
902648180 1:17818644-17818666 CTGAATGAAGTGAGGGAATAAGG - Intronic
903056153 1:20637651-20637673 CTGAATAATGAGAAAGAAGATGG + Intronic
903600381 1:24534042-24534064 GAAAGTAAAGAGAAGGAAAAAGG - Intronic
904075592 1:27839530-27839552 AAAAATAAAGAAAAGGAAAAAGG + Intronic
904427038 1:30434548-30434570 CTAAATAAAGGGAAAGTTTATGG + Intergenic
905652087 1:39663283-39663305 CTAAGTGAAGAGGAAGAATATGG - Intronic
907261761 1:53223550-53223572 CTTAACAAAGAGATGGAAAAAGG + Intergenic
908891252 1:68850592-68850614 ATAAATAAATAGGAAGAATATGG - Intergenic
908960353 1:69690352-69690374 CTCAATAACTAGAAGGAATCAGG + Intronic
909330448 1:74403219-74403241 CTAAATACAGTGAAGAATTAAGG - Intronic
909758265 1:79255440-79255462 TTAAATATAGACAAGGAACATGG - Intergenic
909845278 1:80386428-80386450 CTCAAGCAAGAGAAGGAAAATGG + Intergenic
910273479 1:85422227-85422249 CTAATTAAAAAGTAGGAAAAAGG - Intronic
910588734 1:88906377-88906399 CAAAACAAAGAAAAGGAATGGGG + Intergenic
910840672 1:91558254-91558276 TTAAATAAAAAGAATGAATAAGG - Intergenic
911267883 1:95764337-95764359 ATAAATAGAAAGAATGAATAAGG + Intergenic
911396998 1:97322250-97322272 ATAAATAAATAAAAGGAATTAGG + Intronic
911572489 1:99534771-99534793 CCAAACAAAAAGCAGGAATAGGG + Intergenic
911633102 1:100204654-100204676 CTAAACAAAAAGAAGGAAGCTGG + Intronic
911637536 1:100251532-100251554 CTAAAAAAAGAGAAGAAATGGGG - Intergenic
911850641 1:102814893-102814915 CTAAGTAAAAAGAACGAATTTGG - Intergenic
912024490 1:105150770-105150792 CTGAACAAAAAGAAAGAATATGG + Intergenic
912164459 1:107025845-107025867 CTAAATAGAGATAAAGAGTATGG - Intergenic
912228489 1:107763886-107763908 CTGAACAAAGAAAAGGAAAAGGG + Intronic
912308442 1:108595284-108595306 AAGAATAAAGAGAAGGAAGAAGG + Intronic
912387547 1:109279512-109279534 CTAAAAAAAGAGAAAGAAATAGG + Intergenic
912799465 1:112712060-112712082 CCAAAGAAAGAAAAGGAATTGGG + Intronic
913271468 1:117097832-117097854 CTCCAAAAAGAAAAGGAATAGGG + Intronic
914238817 1:145837294-145837316 CTCAAAAAAGAAAAGGAAAAAGG + Intronic
915830413 1:159124181-159124203 TTAAAAAAAGAGATGTAATATGG - Intronic
915955465 1:160216990-160217012 GTAAGTACAGAGAATGAATAAGG + Exonic
916149342 1:161771233-161771255 AAGAATAAAGAGAAGGAAAAAGG - Intronic
916947753 1:169745790-169745812 CTAAATACTCAGAAGAAATAAGG + Intronic
917039800 1:170792265-170792287 GTGAATAGAAAGAAGGAATAAGG + Intergenic
917564597 1:176199958-176199980 CTAAATAAAGGCAAGGAAATGGG + Intronic
917954995 1:180086138-180086160 CACAATACAGAGATGGAATAGGG + Intronic
918146544 1:181761277-181761299 ATAAAGAAAGAAAAGGAATGTGG - Intronic
918537835 1:185594101-185594123 CTGAATAAAAAGAAGGAATCAGG - Intergenic
918561806 1:185877938-185877960 CTAAATAATGAGAACCAATGGGG - Intronic
918680904 1:187351736-187351758 CTAATTAAAAAGAAGAAAAAAGG + Intergenic
920297278 1:204966684-204966706 CTACAGAAAGAGAAATAATATGG + Intronic
920423825 1:205857507-205857529 CTAAACAAAAAGAAGAAATCTGG + Intergenic
920437348 1:205956064-205956086 ATAAAGAAAGAGAAGAAAGAAGG - Intergenic
920824651 1:209413993-209414015 CTGAGCAAAGAGAAGGAAAACGG + Intergenic
921175702 1:212592524-212592546 AAAAATAAGGAGAAAGAATATGG - Intronic
921555096 1:216589074-216589096 CTAAAGAAAGATAAGAAGTATGG + Intronic
921559182 1:216636393-216636415 CAAAATAAAGAAAAAGAATAAGG + Intronic
921866177 1:220090000-220090022 CTAAAAAAAGAAAAAGAAGAAGG + Intronic
922146753 1:222954006-222954028 CTAAATAACTAGCACGAATATGG - Intronic
922454090 1:225760590-225760612 CAAAAGAAAGAGAAGAAATGTGG - Intergenic
923062147 1:230485554-230485576 ATGAAAAAAGAGAAGGAAAAAGG - Intergenic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923413814 1:233735120-233735142 ATTAATAAAGTGAAGGAATAAGG - Intergenic
923878604 1:238077746-238077768 CAAAATAAAAAGAAGTAAAAGGG - Intergenic
923963935 1:239115254-239115276 GTAATAAATGAGAAGGAATAAGG + Intergenic
924062075 1:240185201-240185223 TAAAAGAAAGAGAAGGAAAAAGG - Intronic
1063242332 10:4183947-4183969 CTAAATAAACAGCAGAAATGTGG - Intergenic
1063530809 10:6829736-6829758 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
1064987983 10:21230190-21230212 CTAAAGAAATATAAAGAATATGG + Intergenic
1065418195 10:25511974-25511996 CTAAGCAAAGAGAACAAATATGG - Intronic
1065469607 10:26064129-26064151 CTAAAAATAGAGCAGGAAAAGGG + Intronic
1066221671 10:33340877-33340899 CAAAATAAATTGAAGGAAAAAGG - Intergenic
1066239867 10:33523251-33523273 CTAATTAAAGAGCAGGACAAGGG - Intergenic
1066504068 10:36023787-36023809 CTGAAGGAAGAGAAGGAAGAAGG - Intergenic
1066728025 10:38411618-38411640 CTCAAAAAAAAGAAAGAATATGG + Intergenic
1067422363 10:46164882-46164904 ATAAATAGAGAGAGAGAATAGGG - Intergenic
1067436773 10:46284247-46284269 CGAAAGAGAGAGAAGGAAAAAGG + Intergenic
1067842321 10:49690956-49690978 CTAAATAAACGAAAGGGATATGG - Intronic
1068862079 10:61857559-61857581 CTAAGGAAAGAGAAGAGATAAGG + Intergenic
1069010499 10:63366579-63366601 CTGAATGAAGAGAAAGAATGAGG + Intronic
1069171352 10:65233842-65233864 AAAAAAAAAGAGAAGGAAAATGG - Intergenic
1069205274 10:65675134-65675156 CTACACAAAGAGAAAGAAAAGGG + Intergenic
1069349341 10:67506988-67507010 CTAGCTAAAGAGACTGAATATGG - Intronic
1069719828 10:70542258-70542280 CCACATAAAGAAAAGGAAAAAGG - Intronic
1070640112 10:78162252-78162274 CTGAATAAAGATTAAGAATATGG - Intergenic
1070975883 10:80605152-80605174 AAAAAAAAAGAGGAGGAATAAGG - Intronic
1071128151 10:82359713-82359735 GTAAATAAAGAGAAGAAAAGGGG - Intronic
1071227664 10:83549752-83549774 CAAAATAAAAAGAATGAAGATGG - Intergenic
1071580344 10:86763421-86763443 CTTAAAAAATAGAAGGAACATGG + Intronic
1072257619 10:93635368-93635390 TTAAATTAAAAGAAGGAATGGGG + Intronic
1072302623 10:94076208-94076230 CTAAATAAATAAAAGGGGTACGG + Intronic
1072947656 10:99825025-99825047 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1073219903 10:101862646-101862668 CTAAAAAAAGAAAACGAAAACGG + Intronic
1073658079 10:105439280-105439302 CCAAAAAAAGAGAAAGAAAATGG - Intergenic
1073993799 10:109293387-109293409 ATAAATAGAGATAAGGAATCTGG - Intergenic
1074748668 10:116561763-116561785 CTAAAGAAACAGAAGGCATTAGG - Intronic
1074863347 10:117530005-117530027 CTGAAAAAAAAGAAGGAATTAGG - Intergenic
1074983975 10:118641420-118641442 CTAAATAAAGCCAAGGAAATTGG - Intergenic
1075004900 10:118823081-118823103 CCTAACAAAGAGAAGGAACAGGG - Intergenic
1075350274 10:121718186-121718208 CTAAATGAAGAGAAAGAATAAGG + Intergenic
1075509562 10:123060086-123060108 TGAAATAAAGAGATGGAAAAAGG + Intergenic
1077267340 11:1657944-1657966 CAAAAAAAAGAAAAGAAATATGG - Intergenic
1078614198 11:12849796-12849818 CTGAATAAATAGCAGGAATGAGG - Intronic
1079166134 11:18045247-18045269 CTAAATAAGGAGTGGGAATGAGG + Intergenic
1079383796 11:19961084-19961106 TTAAAAAAAGAAAAGAAATATGG - Intronic
1079597535 11:22269246-22269268 AAAAAGAAAGAGAAGGAAAAGGG + Intronic
1079597549 11:22269324-22269346 AAAAAGAAAGAGAAGGAAAAGGG + Intronic
1080091054 11:28349434-28349456 CTAAATAAAGGAAAGGAAAGAGG + Intergenic
1080158201 11:29138185-29138207 CTAATAAAGGAGGAGGAATATGG - Intergenic
1080281151 11:30558379-30558401 CAAAAGAAAGAGAAAGAAAAAGG - Intronic
1080617822 11:33960291-33960313 CTTCATAAAGAGAAGGGAGAGGG + Intergenic
1080780729 11:35427511-35427533 CTAAAGAAGGAGAAAAAATAAGG + Intergenic
1080987293 11:37483936-37483958 CTAACTGAAGAGAAAGCATATGG - Intergenic
1082269204 11:50151122-50151144 CAAAATAAAGGGAAGGAGGAAGG + Intergenic
1083394273 11:62378896-62378918 ATCAAGAAAGAAAAGGAATAGGG - Intronic
1085268455 11:75252993-75253015 CTAAAAAAAGAAAATGAAAATGG - Intergenic
1085847742 11:80085128-80085150 ATGAATAAAAAGAAGGAAAAAGG - Intergenic
1085923533 11:80987652-80987674 CTAAATAAAGATATTGAATTTGG + Intergenic
1086478707 11:87209335-87209357 CAAAATAAAGAGATGGAGAAAGG + Intronic
1087244219 11:95815526-95815548 CTTAATAAAGAAAAGTTATATGG + Intronic
1087557718 11:99743819-99743841 CTAAATATAGATAAGTATTAAGG + Intronic
1087580742 11:100048666-100048688 CTAGATAAAGAGAAGTAAAATGG + Intronic
1087724175 11:101698946-101698968 ATCAAAAAAGAGAAGGAATAGGG + Intronic
1087911078 11:103754007-103754029 CAAAACAATGAGAAGGAAAATGG + Intergenic
1088374309 11:109123444-109123466 ATACATAAAGAGAAGGCACAGGG + Intergenic
1089471665 11:118726274-118726296 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1089545101 11:119218070-119218092 CTAAATAAAGGAAAGGAAAAAGG + Intronic
1089906282 11:122043014-122043036 CCAAATAAAAATAAGGAAAAAGG - Intergenic
1090541866 11:127715526-127715548 AAAAATAAAGAGCAGGAAGAAGG - Intergenic
1090904221 11:131060128-131060150 GTGAATAAAAAGGAGGAATATGG + Intergenic
1091415306 12:277633-277655 CTAAATACAGAGAAGAGGTAAGG + Intergenic
1093102062 12:15039039-15039061 GTTAAGAAAGAGAAGGAATGGGG - Intergenic
1093110985 12:15151744-15151766 CTAAGCAAAGAGAACTAATATGG + Intronic
1093307256 12:17536621-17536643 CAAAAGTAAGAGGAGGAATATGG + Intergenic
1093333742 12:17875125-17875147 CAAAATAAAGAAAAGCAGTAGGG - Intergenic
1093577105 12:20744980-20745002 GTAAGTAAAAAGAAGGAAAATGG + Intronic
1093739872 12:22672681-22672703 CAAACTAAAGAGAAGGAAAGGGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094348119 12:29494125-29494147 CTACATAAAGTGAGGGAATAAGG - Intronic
1094627400 12:32136926-32136948 CTAAATAAAGAACTGGAATATGG - Intronic
1095475791 12:42586173-42586195 CACAATAAAGAGAAGGAGTTAGG - Intronic
1095657697 12:44689639-44689661 CTAAATAAAGAAAAGGAGCATGG - Intronic
1095798363 12:46245889-46245911 ATTAAAAAAGAGAAGGAAGAGGG - Intronic
1096015457 12:48269124-48269146 CTCAATAAAGAAAAGGATTTGGG - Intergenic
1096257012 12:50069227-50069249 ATAAATAAAGAGGAGTAATTAGG - Intronic
1096779482 12:53983947-53983969 TTAAATAAAAGGAAGAAATAAGG - Intergenic
1096923692 12:55117972-55117994 CTAAATAAAGAGAAAAATGAGGG + Intergenic
1097331006 12:58333010-58333032 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1097446738 12:59680601-59680623 CTATATAAAGAAAATAAATACGG - Intronic
1097755820 12:63405758-63405780 CTTGATAAAGAGAAACAATATGG - Intergenic
1098096600 12:66963480-66963502 ATGAAGAAAAAGAAGGAATAAGG + Intergenic
1098167861 12:67716708-67716730 CTAAATGAAGCAAAGGAAAAAGG - Intergenic
1098858383 12:75680176-75680198 CTATCCAAAGAGAAGGACTAAGG + Intergenic
1099056431 12:77847292-77847314 ATAAAAACAGAGAAGGAAAACGG - Intronic
1099144956 12:79030802-79030824 TTAAATTAAGTGAAGGAGTAAGG + Intronic
1099384171 12:81994358-81994380 CTAAATTATTAGGAGGAATAAGG + Intergenic
1099741151 12:86635975-86635997 CTAAATATAGAAAAGGAACAGGG - Intronic
1099807517 12:87538510-87538532 AGAAATAATGAGAAGAAATATGG + Intergenic
1099951222 12:89306587-89306609 TTTAATAGAGAGAAGGAACAGGG + Intergenic
1100120714 12:91366503-91366525 ATAATTAAAGAGAAGAAAAATGG + Intergenic
1100429960 12:94522572-94522594 ATAAATAAAGGAAAGGAATTGGG - Intergenic
1100558089 12:95717740-95717762 CTAGATAAGGAGCAGGAAAATGG + Intronic
1101037578 12:100720346-100720368 CTAAATGAAGAAAAGGAATGAGG + Intronic
1101774370 12:107780152-107780174 ATAAATAAAGAGAAGAAAGCAGG + Intergenic
1101792471 12:107940323-107940345 AAAAAAAAACAGAAGGAATAAGG - Intergenic
1102271516 12:111540166-111540188 ATAAAGCAAGAGAAGGAATGTGG - Intronic
1102803012 12:115753171-115753193 AGAAATATAGAGAAGGAAGAAGG - Intergenic
1103080443 12:118019730-118019752 CTATATAAAGACAAAGAATTTGG + Exonic
1103115751 12:118329720-118329742 CTAAATAAAAACAAGGGACATGG + Intronic
1108402979 13:50067292-50067314 CAAAAGAAAGGGAAGGAAAAGGG + Intergenic
1108860065 13:54845936-54845958 GTAAATAAAGATACGGAATCAGG - Intergenic
1109111155 13:58319575-58319597 CTAGGTAATAAGAAGGAATAGGG - Intergenic
1109421923 13:62124435-62124457 CTAAAAAAAAAGAAGGAAATAGG - Intergenic
1109606631 13:64705813-64705835 CAGAATTAAGAGAAGGAAAAGGG - Intergenic
1110018608 13:70440304-70440326 GTAAATATGGAGAAAGAATAAGG - Intergenic
1110152713 13:72274230-72274252 CAAAAAAAAAAAAAGGAATATGG + Intergenic
1110182186 13:72630665-72630687 CTAAACAAAAAGAACAAATATGG + Intergenic
1110548234 13:76781018-76781040 CTAAGGAGAAAGAAGGAATATGG + Intergenic
1110710527 13:78646000-78646022 TTAAAAAAAGAGATGGAAAAGGG - Intronic
1110907427 13:80909854-80909876 TGAAATAAAGAGAAGGATTAAGG - Intergenic
1111022293 13:82467726-82467748 CAAAATAAATAGAATGAATAAGG - Intergenic
1111593295 13:90377818-90377840 CTAATTAGGGAGAAGGACTAGGG + Intergenic
1112374997 13:98830843-98830865 TTAAATACAGAGATGGAAAAGGG + Intronic
1112583368 13:100695346-100695368 CTGTAAAAAAAGAAGGAATATGG - Intergenic
1112701229 13:102011314-102011336 GTAAGAAAAGGGAAGGAATATGG - Intronic
1113034596 13:106035503-106035525 CTAAAGAAAGAGAATGCAAATGG + Intergenic
1114898479 14:27025706-27025728 ATAGTTAAAGAGAATGAATAAGG - Intergenic
1115015982 14:28614781-28614803 CTAAAGAATGAGCAGGAATTAGG - Intergenic
1115057900 14:29153013-29153035 ATAAAAAATGAGGAGGAATAGGG + Intergenic
1115377140 14:32689489-32689511 ATTAATAAATAAAAGGAATATGG - Intronic
1115396309 14:32912553-32912575 GTGAATAAAGAGAAGGAGAAGGG + Intergenic
1116236114 14:42281330-42281352 ATAAATAAAAAGAATCAATATGG - Intergenic
1116280103 14:42895797-42895819 CTAAATAAAAAGAATGAAGCTGG - Intergenic
1116568471 14:46483572-46483594 ATAAATAATGAGAAGGACTGTGG - Intergenic
1116824156 14:49656000-49656022 CTAAAACAAGATAAGCAATATGG + Intronic
1116896611 14:50321605-50321627 CTAAATAAAGTGAAGAAATGTGG + Intronic
1117043655 14:51790930-51790952 CCAAATAAAGTGAGGGAATGAGG + Intergenic
1117184276 14:53224065-53224087 CAAAATTAATAGAAAGAATAAGG - Intergenic
1117330004 14:54703018-54703040 ATAAATAAAGAGAAAGAAAGAGG - Intronic
1117744761 14:58858219-58858241 CTAAATAAAGGGATAGAAAAAGG - Intergenic
1118374855 14:65167796-65167818 GTAAATAAACAAAAGGGATAAGG - Intergenic
1118886555 14:69871741-69871763 ATATATAAAGAGAAGAATTAGGG - Intronic
1120077756 14:80179455-80179477 AAAAATAAAGAAAAGGAAGAGGG + Intergenic
1120280694 14:82434146-82434168 CTAAATAAAGAGTTAAAATATGG - Intergenic
1120839392 14:89070666-89070688 AAAAATAAAAATAAGGAATAAGG + Intergenic
1121516204 14:94552120-94552142 CTAAACAAAAAGTAGGAATCTGG - Intergenic
1121567315 14:94919890-94919912 CTATATAAAGAGTACGAAGAAGG + Intergenic
1122173462 14:99897480-99897502 ATAACTAAAGAGAAGGAAGAGGG + Intronic
1122251143 14:100440742-100440764 GTAAATAATCAGAAGTAATATGG - Intronic
1122998386 14:105277753-105277775 CTCAAAAAAGAGAAAGAAGATGG - Intronic
1125291105 15:38147912-38147934 CTATATAAATCGAAGGTATATGG - Intergenic
1125349271 15:38750820-38750842 AAAAGTAAAGAGAAGAAATAAGG + Intergenic
1125786263 15:42320994-42321016 CTGAGTAAAGAGAAGAAAAAAGG - Intronic
1126024058 15:44428911-44428933 GTTCATAAAGAGAAGTAATAAGG + Intronic
1126056417 15:44734032-44734054 CAAAGTAGAGAGAAGGAATTTGG + Intronic
1127210787 15:56772482-56772504 TTAAATAAAGAGCAGGAGGAAGG + Intronic
1127250799 15:57235659-57235681 CAGAATCAGGAGAAGGAATATGG - Intronic
1127269997 15:57391839-57391861 CTGAATAAGGATATGGAATAAGG - Intronic
1127532576 15:59859095-59859117 ACAAATAAAGAGAATAAATATGG + Intergenic
1128198150 15:65779153-65779175 CAAATTCAAGAGAAGGAAAAAGG + Intronic
1129555953 15:76509773-76509795 CTAAACAAAAAGAACGAATCTGG + Intronic
1131034953 15:89216031-89216053 TTAAATAATGGTAAGGAATAAGG - Intronic
1131105478 15:89731287-89731309 CTTCATAAAGAGAAGGATGATGG + Intronic
1131246738 15:90800680-90800702 CAAAAAAAAAAGAAGGAACAGGG + Intronic
1132033782 15:98462175-98462197 CTAAGCAAAAAGAAGAAATATGG + Intronic
1132272265 15:100536819-100536841 CTAAACAGATAGGAGGAATAAGG + Intronic
1133950891 16:10391423-10391445 ATAAAAAAAGAAAAGGAATATGG + Intronic
1134901968 16:17946477-17946499 TTAAATAAAGAGATGGACTGTGG + Intergenic
1135142854 16:19936360-19936382 GGAAATAAAGACAGGGAATATGG - Intergenic
1135405642 16:22195662-22195684 CTACATAAAGAGATGGTTTATGG + Intergenic
1135508431 16:23059630-23059652 CTAAACAAAGGGAAGGCACAGGG + Intergenic
1135972226 16:27080857-27080879 CTGAAGAGAGAGAAGGAAAAGGG - Intergenic
1136939125 16:34503718-34503740 CTATATGAAGAAAAGCAATAAGG - Intergenic
1136960695 16:34844843-34844865 CTATATGAAGAAAAGCAATAAGG + Intergenic
1139100880 16:63765308-63765330 ATAAATAAATAGAAGTATTATGG - Intergenic
1139166768 16:64575483-64575505 GGAAATAAAGTGAAGGAAAAGGG + Intergenic
1140795573 16:78434447-78434469 TTACATGAAAAGAAGGAATATGG + Intronic
1140876908 16:79161433-79161455 CTAAAGAGAGAGGAGGAGTAGGG + Intronic
1140990548 16:80207033-80207055 CTAAATAACAAGAGGGAACAAGG - Intergenic
1141861170 16:86717609-86717631 CTAAGCAAAAAGAAGGAAGATGG + Intergenic
1143228913 17:5334228-5334250 CAAAAAAAAGAGAAGGAAAGGGG - Intronic
1143414720 17:6737806-6737828 CTAAATAAAGATAACAAATCTGG + Intergenic
1144074253 17:11702689-11702711 CAAAATAAAGAGGATGAAGAAGG + Intronic
1144802567 17:17940577-17940599 CTGAACAAAGAGCAGGAATAAGG + Intronic
1145741119 17:27275543-27275565 CTAAATAAAGATAACAACTAAGG - Intergenic
1146372082 17:32271107-32271129 CTGAATCAACAGAAGGAATCAGG - Intronic
1147310781 17:39595148-39595170 GTGAATGAAGAGAAGGAATTGGG - Intergenic
1147399849 17:40174187-40174209 CTAAAAAAAAAAAAGGAATTAGG - Intergenic
1147806052 17:43132576-43132598 CTAAAAAAAGAAAAAGAAAAAGG - Intergenic
1148368498 17:47074622-47074644 CTAAATAAGGGGAAAGAATAGGG - Intergenic
1148693828 17:49547566-49547588 CTCAATATAGAGAAGGAAACGGG - Intergenic
1149107181 17:52983522-52983544 TTAAATGAGGAGAAGGATTATGG + Intergenic
1149107976 17:52992205-52992227 CTAAAGATAGCTAAGGAATAAGG - Intergenic
1149680348 17:58502544-58502566 CTAAATGATGAGTAGGAATCTGG + Intronic
1150748218 17:67833999-67834021 CGAGATGAAGAGAAGAAATAAGG - Intronic
1150775638 17:68079704-68079726 CATAATAAAGAAAATGAATAAGG - Intergenic
1151022495 17:70633759-70633781 CTAAACAATGAAAAGGAATGAGG - Intergenic
1152605841 17:81289623-81289645 ATAAATAAATAAATGGAATAAGG + Intronic
1152797976 17:82317255-82317277 CTCATTTAAGAGAAGGAAAAAGG - Intronic
1153179701 18:2419176-2419198 CTAAATAGAGAGGAGGAAAAAGG + Intergenic
1153375605 18:4373720-4373742 CGAATTAAAGAAAAGAAATAAGG - Intronic
1153674245 18:7442033-7442055 TTAAAAAAAGAAAAGGTATATGG - Intergenic
1155895151 18:31315979-31316001 CTCAATTAAGAAAAGGCATAGGG + Intergenic
1156134014 18:34014269-34014291 CTAAATAAAGTGAAGATTTAGGG + Intronic
1156605301 18:38659304-38659326 AAAAATAAAGAGATAGAATATGG - Intergenic
1156791943 18:40986107-40986129 CAAAATAAAAAGAAGAACTACGG + Intergenic
1157023180 18:43811366-43811388 ATAAACAAAGAGAAAAAATATGG + Intergenic
1157080305 18:44517569-44517591 GTAACTAAAGAGAAGGACTTAGG + Intergenic
1158173891 18:54631863-54631885 CTAAGCAAACAGAAGGATTATGG - Intergenic
1158920119 18:62182475-62182497 TTAAATAAAGGGGAAGAATAGGG - Intronic
1159271956 18:66164355-66164377 ATAAAGGAAGAGATGGAATATGG - Intergenic
1159358370 18:67366633-67366655 GTAAGTAAGGAGAATGAATATGG - Intergenic
1159564439 18:70032466-70032488 CAAAATAAAGGGATGGAAAAAGG + Intronic
1159648312 18:70945917-70945939 GAAAATAAAGAGATGGAAAAAGG + Intergenic
1159785205 18:72705307-72705329 CTAAATGGAGAGAAGAAAGAAGG + Intergenic
1160087206 18:75787432-75787454 ATAAATACAGAGATAGAATAGGG + Intergenic
1160896744 19:1406520-1406542 TTAAATAAATACAAGGAACAAGG - Intergenic
1162233571 19:9286785-9286807 ATAAATAAATAAAAGCAATATGG - Intergenic
1163502217 19:17683071-17683093 ATAAATAAATAGAAAGAAGAAGG + Intronic
1163920141 19:20280558-20280580 ATCAAGAAAGAAAAGGAATAGGG + Intergenic
1164370898 19:27643515-27643537 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
1165265488 19:34659838-34659860 CTAAATAAAAAGAACAAAGATGG + Intronic
1165397713 19:35575956-35575978 ATTAAGAAAGAGAAGGAATAGGG - Intergenic
1165405230 19:35626613-35626635 TTCAATAAAGAGAAGGCAAAAGG + Intergenic
1165781661 19:38438159-38438181 CCAAATAACAAGAAGGAATCAGG - Intronic
1166082924 19:40456029-40456051 ATAAAAAAAGAAAAGGAATATGG + Intronic
1168461023 19:56558535-56558557 CAAAATACAGAGAATGAATCTGG - Intergenic
925523633 2:4775752-4775774 CTGAACAAGGAGAAGGTATAAGG + Intergenic
926438420 2:12861180-12861202 GGAAATACAGAGAAGGAATTAGG - Intergenic
926769960 2:16362161-16362183 CTGAAGATAGAGAATGAATAAGG - Intergenic
926877092 2:17493610-17493632 ATAAATAAATAAAAAGAATAGGG - Intergenic
928001917 2:27530810-27530832 CAAAAAAAATAGAATGAATAAGG + Intergenic
929518191 2:42623554-42623576 AAAAAGAAAGAGAAGGAAAAGGG - Intronic
930581018 2:53211868-53211890 TTAAGAAAAGAGAAGGAAAAAGG + Intergenic
931077376 2:58731169-58731191 CTCAATAAAGAAAAGGAAGAAGG - Intergenic
931269698 2:60690537-60690559 CTAAAGAAAGAGAGGGATGAAGG - Intergenic
932589991 2:73059468-73059490 CTAAATAAGGGGAGGGAATGTGG - Intronic
932883648 2:75527715-75527737 GCAAATAAAGAGAAGATATAAGG + Intronic
933009261 2:77037192-77037214 CTATATACAGAGAGAGAATATGG + Intronic
933417465 2:82004716-82004738 CAAAAAAAAGAAAAGAAATATGG - Intergenic
933563310 2:83917033-83917055 CTAAAGAAGGAGAGGGAATAGGG - Intergenic
933634275 2:84690275-84690297 CTAATTAAAGAGCTGAAATATGG - Intronic
937971588 2:127553200-127553222 CTAAACAAAAAGAACAAATATGG - Intronic
938662801 2:133504801-133504823 CTACATAGAGAGAAGGAAAGAGG - Intronic
939541139 2:143495220-143495242 CTAAATAAAGAAGAGGAAAAGGG - Intronic
939750994 2:146045558-146045580 ATAAATATAGAGAAGCAGTAAGG - Intergenic
939807935 2:146796497-146796519 TTAAATCAAGTGGAGGAATAGGG - Intergenic
940230454 2:151445948-151445970 CTAACTGAAGAGAGGAAATAAGG - Intronic
940262623 2:151798076-151798098 CTAAACAAAGAGGATGAATTTGG + Intronic
940778745 2:157910957-157910979 TTAAAGAAAGAGAAGGACTGTGG - Intronic
941477753 2:165969280-165969302 ATGAATAAAGAGAAGAAATTTGG + Intergenic
941486610 2:166089689-166089711 CTATATAAAAAGATGGAATGGGG + Intronic
941870215 2:170376588-170376610 AAAAATAGAGAGAGGGAATAAGG - Intronic
941968762 2:171327230-171327252 CTAAATCAAGAGCAGCTATAAGG - Intronic
942407988 2:175675976-175675998 GGAAATAGAGAGAAGAAATAAGG + Intergenic
942445442 2:176074451-176074473 CCAAAGAAAGAGAAGGGATCAGG + Intergenic
943135761 2:183910143-183910165 CTAAAAAATGAGGCGGAATATGG - Intergenic
943386255 2:187206972-187206994 CAAAATGAAGAGAAGGAGTTGGG + Intergenic
943700274 2:190981540-190981562 CCAAATAAAGAAATGGAATAAGG + Intronic
943765018 2:191651266-191651288 ATAAAACCAGAGAAGGAATAAGG + Intergenic
944410769 2:199440157-199440179 ATAAATAGAAAGAAAGAATAGGG + Intronic
944487444 2:200221750-200221772 CTAAAGAAAGAGAAGAAATTGGG - Intergenic
945266717 2:207898101-207898123 CTGAATTACGAGAAGGAATTTGG - Intronic
945283962 2:208064001-208064023 CTAAATAAATGGAAGGACAAAGG + Intergenic
945407388 2:209466292-209466314 CTACTTTGAGAGAAGGAATATGG - Intronic
945643721 2:212462869-212462891 ATAAATAAATAAAGGGAATATGG + Intronic
946059445 2:216929169-216929191 ATAAATAAATAAAAGAAATAGGG - Intergenic
946588762 2:221219994-221220016 CTAAAGAAAGATGAGGAAAAGGG - Intergenic
946990283 2:225321555-225321577 CAAAATAAAGATTAAGAATATGG - Intergenic
947221237 2:227794541-227794563 CTAAAAAAAAAAAAGAAATAAGG + Intergenic
1169658932 20:7957061-7957083 CAAAATATAGAGAAAGAAAAAGG - Intergenic
1169842425 20:9954718-9954740 CTAAATGAAGAGTGGGAATTAGG - Intergenic
1170462650 20:16591941-16591963 ATAAAGGAAGAGAAGGAGTATGG + Intergenic
1170795169 20:19540800-19540822 CTATATAAAGGGACGGAAGATGG - Intronic
1170870909 20:20205497-20205519 CAAACTACAGAAAAGGAATATGG + Intronic
1171395817 20:24832440-24832462 CTAAACAAAGATAAGGATTTTGG - Intergenic
1172055423 20:32151144-32151166 CTCAAGCAAGAGAAGAAATAGGG + Intronic
1172798562 20:37560268-37560290 CTTAAGAAAGTAAAGGAATAGGG - Intergenic
1173086066 20:39919447-39919469 CAAAATAAAGGGATGGAAGAAGG - Intergenic
1173215433 20:41077606-41077628 ATAAAGAAGGAGAAGGAAAATGG + Exonic
1173328485 20:42054697-42054719 CCAAAGAGAGAGAAGGAATGTGG - Intergenic
1173544080 20:43879168-43879190 TTAAAGGAAGAAAAGGAATATGG - Intergenic
1174523840 20:51155632-51155654 TTAAAAAAATAAAAGGAATATGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1176916590 21:14633235-14633257 CTAGAGAAACAGAAGTAATAGGG - Intronic
1176924137 21:14726051-14726073 GTAAATAAAGAAAAGAAACAAGG + Intergenic
1177248757 21:18565900-18565922 ATCAAGAAAAAGAAGGAATAAGG - Intergenic
1177365954 21:20136709-20136731 AAAAATAAAGAAAAAGAATAAGG - Intergenic
1178406647 21:32329618-32329640 CTCAAAGAAGGGAAGGAATAAGG + Intronic
1178804886 21:35830998-35831020 GTAAAATAAGAGAAGGAAAATGG + Intronic
1178863509 21:36308864-36308886 ATAAATAAATAAAAGGAATTAGG - Intergenic
1179370596 21:40802831-40802853 ATTTATAAAGAAAAGGAATATGG - Intronic
1179393611 21:41016825-41016847 CTAATTTAAAATAAGGAATAAGG - Intergenic
1179963860 21:44788877-44788899 CCAAATAAATATAAGGTATAAGG + Intronic
1180782920 22:18530874-18530896 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1180838183 22:18942557-18942579 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
1180911210 22:19451958-19451980 CTCACTAAAATGAAGGAATAAGG - Intronic
1181239818 22:21470236-21470258 CCAAATAAACAGAAGGAAAGGGG - Intergenic
1181535642 22:23541716-23541738 ATCAAAAAAGAAAAGGAATAGGG + Intergenic
1181974040 22:26715416-26715438 ATAAATAAAGAAAAGGGATAAGG - Intergenic
1182570213 22:31231632-31231654 CAAAGTAAAGAGCAGGATTAAGG - Intronic
1182677796 22:32053420-32053442 CCAAAAAAAGAGAAGGATGAAGG - Intronic
1182992438 22:34781309-34781331 CTAAATAAAGAGACTGACTTGGG + Intergenic
1183149468 22:36026794-36026816 CTAAATCAACAGAAGTAACAGGG + Intronic
1184509241 22:44922729-44922751 ATAAATAAAAATAAGAAATAGGG + Intronic
1184686195 22:46097462-46097484 CTAAATAATGGGTAGGAATGGGG + Intronic
1184791851 22:46704989-46705011 GTAAATAAAGATAGTGAATAAGG + Intronic
949271754 3:2225159-2225181 CCAAAAAAAAAGAAGTAATAAGG + Intronic
949583066 3:5410455-5410477 CTGAAAGAAGTGAAGGAATATGG + Intergenic
949758164 3:7437994-7438016 AAATATAATGAGAAGGAATACGG + Intronic
950160865 3:10760018-10760040 CTAAATAAAGATATCTAATAAGG - Intergenic
950229890 3:11267228-11267250 ATTAAGAAAGAAAAGGAATAGGG - Intergenic
950232626 3:11289903-11289925 CAAAGTACAGGGAAGGAATAAGG + Intronic
950598864 3:14012843-14012865 CTAAACAAAAAGAAGAAATCTGG - Intronic
950956881 3:17063304-17063326 CTAAAAAAAAAGAAGGAAGGAGG - Intronic
950981077 3:17304920-17304942 CTAAATAAAAACAAAGAATATGG - Intronic
951268666 3:20599839-20599861 CAAAATAAAGAGATGGAGAAAGG - Intergenic
951290271 3:20866155-20866177 CTAAAAAAAAAAAAAGAATAAGG - Intergenic
951400869 3:22230287-22230309 CTATAAAAAAAGAAGGAAAATGG + Intronic
951604911 3:24422472-24422494 CAAAATAAAGGGAAGTAAAAGGG - Intronic
952389601 3:32868873-32868895 ATAAATATAGGAAAGGAATAGGG - Intronic
953029795 3:39171435-39171457 CTCAATAAAAAGAAAGAAAATGG + Intergenic
954494777 3:50946784-50946806 CTAAAAAGAGAGAAGGATGAAGG - Intronic
955279275 3:57578800-57578822 CAAAATAAATGGAAGGAATTAGG + Intronic
955507089 3:59643191-59643213 CTAAATATAGAAAAGGTATATGG - Intergenic
955565539 3:60240628-60240650 ACAAAGAAAGAGAAGGAAGAGGG + Intronic
955768690 3:62369601-62369623 CCAAAGAACGAGAAGGAATTAGG - Intergenic
955903612 3:63783776-63783798 CTACAAGAATAGAAGGAATAAGG + Intergenic
955990168 3:64618255-64618277 CTAATTAAAGAAAAGGTAAAGGG - Intronic
955993666 3:64655692-64655714 CTAAATACAGAGAAGAATTATGG + Intronic
956063974 3:65377640-65377662 AAAAATAAAGAGAAGGAAGAGGG - Intronic
956226743 3:66968666-66968688 CTGAAGAAATATAAGGAATAGGG - Intergenic
957122006 3:76105795-76105817 TCCAATAAGGAGAAGGAATATGG + Intronic
957496258 3:80994872-80994894 CTAAAAGAAAAGAAGGAACAAGG + Intergenic
958075902 3:88678120-88678142 AAAAATAAAGAGAAAGAAAAAGG + Intergenic
958715614 3:97776637-97776659 ATAAATAAACAAAAAGAATAAGG - Intronic
959070324 3:101695723-101695745 TCAAAAAAAGAAAAGGAATAGGG + Intergenic
959285491 3:104403512-104403534 CTAAAGAAAGAGCAGGAATTTGG + Intergenic
959313953 3:104778218-104778240 CCAAATAAAGAGAAAGAGTATGG - Intergenic
960027890 3:113029539-113029561 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
960132097 3:114068163-114068185 CGAAATAAGGAAAAGGTATAAGG - Intronic
960252914 3:115476435-115476457 CTAAACATAGAAAAGGTATAGGG - Intergenic
960260154 3:115558304-115558326 ACAAAGAAAGAGAAGGAAAAGGG + Intergenic
960729310 3:120707828-120707850 CAAATGAAAGAGAAAGAATAGGG - Intronic
960979385 3:123208077-123208099 GAAGATAAAGAGAAGGAAAAAGG - Intronic
961297141 3:125894177-125894199 ATCAAAAAAGAGAAGGAATAGGG + Intergenic
961379980 3:126490746-126490768 CTGACTAAAGAGAAGGAGTAGGG + Intronic
962031477 3:131605382-131605404 CTAGAGAGAGAGAAGGAAGAGGG - Intronic
962604791 3:137024185-137024207 ATAAATAAAAAGAAGGAGGAAGG - Intergenic
962797428 3:138861480-138861502 ATAAATAAATAAAATGAATAAGG + Intergenic
963116576 3:141735431-141735453 CTAAATAAAGGAAAGGGAGAAGG - Intergenic
963245267 3:143052525-143052547 ATAATTGGAGAGAAGGAATATGG + Intronic
963249537 3:143090333-143090355 CCAAATATAGAGAAGGAAAGGGG - Intergenic
963353517 3:144181329-144181351 CTAAATAGACAGAAGGAACTTGG - Intergenic
963514486 3:146291752-146291774 CAAAATAAAGAGATGGAGGAAGG - Intergenic
963695761 3:148564672-148564694 ATCAAGAAAGAGAAGGAATTAGG - Intergenic
964346971 3:155763754-155763776 TAAAAAAAGGAGAAGGAATATGG - Exonic
965013160 3:163123532-163123554 CTACATAAGCAGAAGGAAAAGGG - Intergenic
965029293 3:163342560-163342582 CAAAAGAAAGAGAAAGAAAAAGG - Intergenic
965353100 3:167640089-167640111 CGAAAGAAAGAGAATGAAAAGGG + Intronic
966012589 3:175099412-175099434 CTCAATAAAGAAAACAAATATGG - Intronic
966197086 3:177324317-177324339 CTATAAAAAGAAAAGAAATATGG + Intergenic
966238003 3:177724343-177724365 CTAAATAAACATTTGGAATAGGG - Intergenic
966428462 3:179806624-179806646 CTAAATAAATAATAGTAATAAGG + Intronic
966518720 3:180849349-180849371 AGAAATAATGAGCAGGAATAAGG + Intronic
967026322 3:185567822-185567844 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
967099832 3:186207246-186207268 CAAAATAAAGACTGGGAATAAGG + Intronic
968396647 4:244430-244452 ATCAAGAAAGAAAAGGAATACGG + Intergenic
970387559 4:15571098-15571120 TTAAATAAAGGTAAAGAATAAGG + Intronic
970557822 4:17253409-17253431 CTAAAAAAAGAGAAGAACTACGG - Intergenic
970664833 4:18324769-18324791 ATAAATAAAGAAGAGGAATTGGG - Intergenic
970696976 4:18689745-18689767 CTGATTAAAAATAAGGAATAGGG - Intergenic
971050871 4:22861074-22861096 TTAAAAAAAGAGAATGCATATGG - Intergenic
971156461 4:24088359-24088381 CTAAAAAAAAAGAAAGAAGAAGG + Intergenic
971364826 4:25969304-25969326 CTAAATAAAAAGCATGAAAAAGG - Intergenic
971576037 4:28276094-28276116 CTCAAAAAAGATTAGGAATATGG + Intergenic
971670746 4:29553626-29553648 GTAATTAAAATGAAGGAATATGG - Intergenic
972002445 4:34055899-34055921 TTAAATAAAGAACAGAAATAAGG + Intergenic
972059117 4:34846082-34846104 CTAAGTAGAAAGAAGGAATGTGG + Intergenic
972078120 4:35112265-35112287 CTAAATTAAGACAATGAAGAAGG - Intergenic
972238284 4:37159971-37159993 CTAAAAATGGAGAATGAATAAGG - Intergenic
972367513 4:38390351-38390373 CAAAAGAAAGAAAAGGAATGGGG + Intergenic
972443649 4:39121622-39121644 ATAAATAAAGAAAAGCATTAAGG + Intronic
972862434 4:43186591-43186613 CTAAATAAAAAAAGGTAATAAGG + Intergenic
972994384 4:44862117-44862139 GTAAATAAAAATATGGAATATGG - Intergenic
973068789 4:45831397-45831419 CTAAACAAAAAGAAGAAATCTGG - Intergenic
973161882 4:47029954-47029976 AGAAAAAAAGAGAAGGAATATGG - Intronic
973557032 4:52093749-52093771 AGAAAGAAAGAGAAGGTATAGGG - Intronic
973767499 4:54176644-54176666 CCAAACAAAGAGAAGGAAAGGGG - Intronic
974320421 4:60340808-60340830 ATAAATCAAGAGTAGAAATATGG - Intergenic
974900998 4:67998047-67998069 CTAAATAAAAAGAAAGCATAAGG - Intergenic
975031280 4:69620691-69620713 CTAAACAAAAAGAACGAAGATGG + Intronic
975091486 4:70409542-70409564 CTAAATCGAGAGAAAGAAGATGG - Exonic
975774979 4:77776655-77776677 CTAAATGAAGGGAAGGAGTTAGG - Intronic
975877545 4:78860739-78860761 CTAAGAAAAAAGAAGGAATGTGG + Intronic
975967581 4:79993264-79993286 ATAAAGAAAGAGAGGGAAGAAGG + Intronic
975970675 4:80031821-80031843 CTAAAGAAAGAGAAGTGAAAGGG + Intronic
976086731 4:81414468-81414490 CTAAACAAAAAGAAGAAATCTGG + Intergenic
976094443 4:81492925-81492947 CTATAGAAAGAGAAGGATTTAGG + Intronic
976562326 4:86516323-86516345 CTAAATAAAAAGAACAAATCTGG - Intronic
977403123 4:96560702-96560724 CTAAATACAGATAAACAATAAGG + Intergenic
977522245 4:98099522-98099544 ATAAATAGAAAGAATGAATAAGG + Intronic
977661758 4:99596578-99596600 TAAAATAAAGAGAGAGAATAGGG + Intronic
977754088 4:100645245-100645267 ATAAATAAAGAGAAGAAAAGAGG - Intronic
978286156 4:107079509-107079531 TTGAATAAACAGAAGGAATGTGG - Intronic
978853506 4:113366663-113366685 CTAAATAAAGTGAGAGAAAAAGG - Intronic
978859865 4:113435504-113435526 CTATATAAATAGAAGAAACAAGG + Intergenic
978972307 4:114823480-114823502 CAATATAAAGAGAAGGTACAAGG + Intergenic
979479702 4:121202109-121202131 CTAAACAAAAAGAATGAATCTGG + Intronic
979553945 4:122023402-122023424 CTAAACAAAAAGAAGAAATCTGG + Intergenic
979983114 4:127280918-127280940 CTAAATTAAGAGAATGCATCTGG - Intergenic
980146579 4:128992939-128992961 ATATATAAAGAAAAGGGATAAGG - Intronic
980209645 4:129770957-129770979 CTTAGTAGAGAGAAGTAATATGG - Intergenic
980226068 4:129987583-129987605 TTACAGAAAGAGTAGGAATATGG - Intergenic
980794560 4:137664083-137664105 CTAAACAATGAGAAGGAAGTAGG - Intergenic
981050669 4:140306452-140306474 TTCAATAAAGAAAATGAATAGGG + Intronic
981277103 4:142913516-142913538 ACTAATAAAGAGAAAGAATATGG - Intergenic
982001144 4:151022378-151022400 CTGAACAAATAAAAGGAATATGG - Intergenic
982520092 4:156405733-156405755 CTAAACAAAAAGAACAAATATGG + Intergenic
982951038 4:161696400-161696422 CTAAACAAAAAGAACAAATATGG - Intronic
982983010 4:162164748-162164770 TTAAATCATGAGAATGAATAAGG - Intergenic
983157421 4:164367552-164367574 AAAAATCAAGAAAAGGAATATGG - Intronic
983254995 4:165388282-165388304 CTAAAAAAAGAAAAGGAAAAAGG - Intronic
983364900 4:166774171-166774193 GTAAAAATAGAGAAGGATTAAGG - Intronic
983476835 4:168222299-168222321 CTGAATAAAAAGGAGGAAGAAGG + Intronic
983506082 4:168555368-168555390 CTAACTAAAAAGGAGGAAGATGG + Intronic
983518857 4:168686017-168686039 CTAAAAAAAAGGAAGGAAAAAGG - Intronic
983852757 4:172603010-172603032 CTAAATAGACAGAACTAATATGG + Intronic
984123310 4:175772709-175772731 ATAAATAGAGACAAGGAAGATGG - Intronic
984182169 4:176497323-176497345 CTAAAAAAAAAAAAAGAATATGG + Intergenic
984319181 4:178169884-178169906 CTAAATAAAACGAAGGATCATGG + Intergenic
984801451 4:183720942-183720964 ACAAATAAAGAGAAGGAATTAGG - Intergenic
986265347 5:6185675-6185697 CTACCTGAAGAGAAGGCATAAGG + Intergenic
987615344 5:20266742-20266764 CTAAATATTGAAAAGGAAGAGGG + Intronic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
987952950 5:24700028-24700050 GAAAATAAAGATAAAGAATAGGG - Intergenic
988186249 5:27866760-27866782 AAAAAAAAAGAAAAGGAATATGG + Intergenic
988380470 5:30492207-30492229 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
988386389 5:30571319-30571341 TTAAAAAAAGAGAAAGAAAAGGG - Intergenic
989065061 5:37452062-37452084 CAAAATAAAGAGAATGAAATTGG - Intronic
989189942 5:38660862-38660884 TTAAATAAAGAAAAGGAAAAGGG + Intergenic
989526131 5:42455428-42455450 CTATCTAAAGAGAAGGATTGGGG - Intronic
989836924 5:46005298-46005320 ATCAAAAAAGAGAAGGAATAGGG - Intergenic
989845291 5:46133139-46133161 CAAAATAAAGGGATGGAAGAGGG + Intergenic
989847230 5:46159983-46160005 CAAAATAAAGGGATGGAAGAAGG - Intergenic
989955593 5:50355641-50355663 CAAAACAAAGAGAAGGACAAAGG - Intergenic
990395836 5:55377326-55377348 CTAAAAAAAAAGAAGAAAAAAGG + Intronic
990540869 5:56771319-56771341 ATGAATAAAGATAAGGGATAAGG + Intergenic
990707459 5:58545817-58545839 CTAATTAAAGAGATGGCAAAAGG - Intronic
991310751 5:65238599-65238621 CAAAAAAAAAAAAAGGAATATGG + Intronic
991403189 5:66275581-66275603 CTAAATAAAATAAAGGAAAATGG - Intergenic
991748249 5:69769177-69769199 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991799829 5:70349022-70349044 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
991828768 5:70661016-70661038 CTTAAAAAGGAGAAGGAAAAAGG + Intergenic
991892187 5:71348453-71348475 CTTAAAAAGGAGAAGGAAAAAGG - Intergenic
992123156 5:73614933-73614955 ATAAATAAATAAAAAGAATATGG + Intergenic
992973571 5:82088019-82088041 ATAAATAAAAAGAAAGAAAATGG + Intronic
993132123 5:83912101-83912123 CTGAATAATTAGAAGGAAAAAGG - Intergenic
993213942 5:84994584-84994606 CTCAATGATGAGGAGGAATATGG + Intergenic
993530790 5:89022694-89022716 ATAACAAAAGAGATGGAATAGGG + Intergenic
993832094 5:92772580-92772602 GTAAATCAAGAGAGGGAAAAAGG + Intergenic
994248135 5:97504439-97504461 CTAAGTAAGTAGAAGAAATAAGG + Intergenic
994827865 5:104739094-104739116 TAAAATACAGAGAAGGAAAAAGG + Intergenic
995317260 5:110789433-110789455 CTTAACAAAAAGAAGCAATAGGG - Intergenic
996179457 5:120400786-120400808 CCATATAAAGGGAAGGAATGTGG - Intergenic
996539630 5:124616033-124616055 CTAAATAATGAGAACCCATATGG - Intergenic
996700040 5:126441574-126441596 CTAAATAAAGAGAAGGAATATGG - Intronic
996872825 5:128210411-128210433 CCAAATTAAGAGAAGGAAAAAGG + Intergenic
996940347 5:128997851-128997873 TTATATAAAGAGAAGAATTATGG - Intronic
997763312 5:136472207-136472229 ATGCATAAAGAGAAGTAATAAGG + Intergenic
997959283 5:138306831-138306853 AAAAAAAAAGAAAAGGAATAGGG - Intronic
998097995 5:139408190-139408212 CTTAACAGAGAGAGGGAATAAGG + Intergenic
999052300 5:148535688-148535710 CAAAATAATTAAAAGGAATAAGG + Intronic
999952165 5:156662980-156663002 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1000151229 5:158503119-158503141 AGAAAGAAAGAGAAGCAATATGG - Intergenic
1000256463 5:159543412-159543434 GAAAATAAAGAGAAGGAGTGGGG + Intergenic
1001404742 5:171468007-171468029 GTAAATAAAGAGAAAGAATCAGG - Intergenic
1001533793 5:172483711-172483733 CTAATTCCAGATAAGGAATATGG + Intergenic
1001720201 5:173850935-173850957 CTAAAGAAAGATTAGGAATTAGG - Intergenic
1001796213 5:174504459-174504481 CTAAAGATAGAGCAGGAATGGGG - Intergenic
1002539432 5:179896311-179896333 CTAAATGGGGAGAAGGAAAAGGG + Intronic
1003478626 6:6510286-6510308 CTAAAAAATGAAAAGGAAAAAGG - Intergenic
1004311421 6:14549283-14549305 CTGAATGAAGACAAGGAACAGGG + Intergenic
1004444332 6:15684543-15684565 CTAAATATAGAGAATAACTATGG + Intergenic
1004888168 6:20071558-20071580 GTACACAAAGAGAAAGAATAAGG - Intergenic
1004890216 6:20094047-20094069 GAAAATACAGAAAAGGAATAAGG - Intergenic
1005944988 6:30589004-30589026 CTCAAAAAAGAAAAGGAACAGGG - Intronic
1006663552 6:35671501-35671523 GAAAATAAAGGGAAGGAACAAGG + Intronic
1006832954 6:36979831-36979853 CTGTAAAAAAAGAAGGAATAAGG + Intronic
1006978866 6:38129760-38129782 CTAAATAAAAAGAACAAATCTGG - Intronic
1007262359 6:40572651-40572673 CTAAATAAACAGAAAGGACAGGG - Intronic
1007571964 6:42899282-42899304 CTCAAAAAAGAAAAGGAATAGGG - Intergenic
1008293866 6:49753810-49753832 CTAAATAAGGAAAGGAAATATGG - Intergenic
1008319370 6:50088919-50088941 GGAAATAAAGAGAAAGAAAATGG - Intergenic
1008410679 6:51175101-51175123 CTAAATAAATGGAATGAATGAGG + Intergenic
1008533502 6:52487591-52487613 ATAAGCAAAAAGAAGGAATAAGG - Intronic
1008949162 6:57136320-57136342 CTAAAAAAAAGGAAGGAATTGGG - Intronic
1009294470 6:61928341-61928363 GTAAATAAGAAGAAGGAATAAGG - Intronic
1009669425 6:66727805-66727827 AGAAATAAAGAGAAAGTATATGG - Intergenic
1009937080 6:70246532-70246554 CTAAATAAAGATAAGGAATGGGG - Intronic
1009990208 6:70833893-70833915 CAAAATAAAGAGAAACACTAAGG - Intronic
1010331933 6:74633460-74633482 TTAAATAAAAAGAAGGAACATGG - Intergenic
1010423608 6:75701978-75702000 TTACATAAAGAGAAGGCAAAGGG + Intronic
1010455638 6:76051155-76051177 CTAAAAAAAGTGAGGGACTATGG + Intronic
1010591944 6:77722469-77722491 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1010929604 6:81785092-81785114 TGAAATAAAGGGAAGGAACATGG - Intergenic
1011049641 6:83130635-83130657 ATAAAGAAAGAGAAGTATTAGGG + Intronic
1011160560 6:84385240-84385262 CTAAGCAAAGAGAAGAAATCTGG + Intergenic
1011322601 6:86113387-86113409 GAAAATAAAGAGATGGAAAAAGG - Intergenic
1011529938 6:88311301-88311323 CTTAAACTAGAGAAGGAATAGGG - Intergenic
1011836090 6:91433102-91433124 GTAATGAAAGAGAAGGAATTTGG - Intergenic
1012517171 6:100075795-100075817 CTAGAGAAAGAGAAGGAACTGGG + Intergenic
1012850562 6:104441982-104442004 CTATATAAAGAGAAGAATTTAGG - Intergenic
1012851481 6:104451741-104451763 CTATAAATATAGAAGGAATAAGG + Intergenic
1012931310 6:105320001-105320023 TTAAACAAAGTGAAGTAATAGGG - Intronic
1013853694 6:114545669-114545691 CTGAAGATAGAGAAGGAATCAGG + Intergenic
1013952518 6:115801547-115801569 CTAAGTAAATAGAAGGCAAATGG + Intergenic
1014144579 6:117982758-117982780 CTACTCAAAGAGAATGAATACGG + Intronic
1014192512 6:118514180-118514202 CTAATTCAAGAGAAGGCAAAGGG + Intronic
1014429779 6:121354480-121354502 ATAAATAAAAAGAAGGAGAAAGG + Intergenic
1014549276 6:122770916-122770938 CTAAATCAAGTGTAGGTATAGGG - Intergenic
1014673828 6:124340362-124340384 CTAAAAAAAGAAAAGGCCTAGGG - Intronic
1014681413 6:124435160-124435182 CTGGATAACTAGAAGGAATATGG + Intronic
1014739919 6:125137271-125137293 CTAGAGAAAGACAAGGAAAATGG - Intronic
1014863603 6:126501445-126501467 ATAAATAATAATAAGGAATATGG + Intergenic
1015091503 6:129364234-129364256 GTAAACAAAGAGAAGGAGGACGG - Intronic
1015153842 6:130068094-130068116 GGATATAAAGAAAAGGAATAAGG - Intronic
1015389916 6:132670087-132670109 CAAAAGGAAGAGAAGGAAGAGGG + Intergenic
1015565952 6:134571563-134571585 CTAAACAAAAAGAACAAATATGG + Intergenic
1015672948 6:135711237-135711259 CTAAATAGAGAGAATGAGAAGGG + Intergenic
1015807765 6:137128979-137129001 CTAAATAAAAAGAACAAATCTGG - Intergenic
1015964393 6:138683536-138683558 CTAAACAAAGAGAAGGAAAAGGG + Intronic
1016029475 6:139322767-139322789 CTACAGAAAAAGAAGGAACAAGG - Intergenic
1016437957 6:144057237-144057259 CTATATAAAGACAAGGCACATGG + Intronic
1016722249 6:147313971-147313993 CAGAATAAAGTGCAGGAATAAGG - Exonic
1017175539 6:151500374-151500396 AAAAAGAAACAGAAGGAATAGGG + Intronic
1017260681 6:152383201-152383223 TTCCATAAAGACAAGGAATATGG - Intronic
1017288449 6:152706054-152706076 CTAAAAAAAGAGAAGGACCCTGG + Intronic
1017318896 6:153065087-153065109 TAAAATAAAGGGATGGAATAAGG + Intronic
1019821330 7:3245402-3245424 CTAAAAAAAGAAAAGGAAAAAGG - Intergenic
1019976620 7:4587992-4588014 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1019977556 7:4596496-4596518 ATCAAGAAAGAGAAGGAATAGGG - Intergenic
1020656872 7:10939074-10939096 CTAAAGAAAGAAATGGAATTTGG + Intronic
1020833232 7:13116638-13116660 CTGAAGAAAGAGATGGAAAATGG - Intergenic
1021035967 7:15799474-15799496 CTCTTTAAAGAGAAGAAATATGG + Intergenic
1021097539 7:16550470-16550492 CAACATAAAGAAAAGGAGTAAGG - Intronic
1021360176 7:19703301-19703323 TGCAATAAAGAGAAGGAATTGGG + Intronic
1021465512 7:20938617-20938639 ATATACAAAGAGAAGGAAAAAGG + Intergenic
1023657266 7:42436618-42436640 CTAAACAAAAAGAACAAATATGG - Intergenic
1023672725 7:42595471-42595493 TTAATTAAACAGAAGGAATCAGG + Intergenic
1023756296 7:43420735-43420757 CTAACTGCAGAGGAGGAATATGG + Intronic
1024090220 7:45932970-45932992 CCAGATGAAGAGAAGGAATGTGG - Intergenic
1024771229 7:52725481-52725503 CCAAATAAAGACAAGGTAAATGG + Intergenic
1025195024 7:56925908-56925930 ATAAATAAATAAAAGGAATTTGG + Intergenic
1025279051 7:57613850-57613872 CTAAAAAAAGATAAGAAAAAGGG + Intergenic
1025305680 7:57851650-57851672 CTAAAAAAAGATAAGAAAAAGGG - Intergenic
1025676928 7:63651035-63651057 ATAAATAAATAAAAGGAATTTGG - Intergenic
1025975223 7:66364331-66364353 CAAAATAAAAAGGAGGAAGATGG + Intronic
1026350158 7:69508610-69508632 AAAAATAAAGAGAAGTAACATGG + Intergenic
1026552893 7:71382758-71382780 CTAGAGAAAGAGAAGGAATTGGG + Intronic
1027206762 7:76106613-76106635 ATAAATAAAGAGAAGCCACATGG - Intergenic
1027386760 7:77666597-77666619 AAAAATAAAAAGAAGAAATATGG - Intergenic
1027926748 7:84474962-84474984 CTAAGAAAAGAGAAGGAAATAGG + Intronic
1029028028 7:97438786-97438808 CTACATGGAGGGAAGGAATAGGG - Intergenic
1029097762 7:98102687-98102709 TAAAATAAAGAAAAGGAAAATGG - Intergenic
1029465623 7:100722922-100722944 CCACAGAAAGGGAAGGAATACGG - Intronic
1029918483 7:104237075-104237097 CAAAATAATGAGAAGTGATAAGG + Intergenic
1029966912 7:104749883-104749905 ATCAAGAAAGAGAAGGAATAGGG - Intronic
1030132724 7:106216750-106216772 CTTATTAAAGACAGGGAATATGG + Intergenic
1030380239 7:108802939-108802961 CTAAGTAAAGAAAAGGAATTTGG + Intergenic
1030716315 7:112811837-112811859 CTGAATGAAGAGAAGGAATGGGG + Intergenic
1030829773 7:114206995-114207017 CTATAGAAACAGAAAGAATAAGG - Intronic
1031099379 7:117460637-117460659 CTAAATAAAAAGAAAGACAAAGG - Intergenic
1031503002 7:122545019-122545041 AAAAGTAAAGAGACGGAATAGGG + Intronic
1031855838 7:126921581-126921603 CCAATTACAGAGAAGGATTAAGG + Intronic
1032152370 7:129440404-129440426 AGAGAAAAAGAGAAGGAATATGG - Intronic
1032260876 7:130335911-130335933 CTACATAAAGAAAGGGAAGAAGG + Intergenic
1032614246 7:133449114-133449136 ATAAATAAATAAAAAGAATATGG + Intronic
1032736294 7:134695617-134695639 GAAAAGAAAGAGAAGGAAGAAGG - Intergenic
1032878693 7:136065704-136065726 ATAAATAAAGAGAAGAATGATGG + Intergenic
1033003994 7:137540356-137540378 CAAAAGAAAGAAAAGGCATAAGG + Intronic
1033427353 7:141256246-141256268 TTAAATTAAAAGAAGGGATAGGG + Intronic
1033482145 7:141753084-141753106 ATCAAGAAAGAAAAGGAATAGGG - Intronic
1033540519 7:142351846-142351868 ATAAAAAAAGTGAAGGAACAAGG + Intergenic
1033993939 7:147322036-147322058 CTAAATATAAAGCAGAAATATGG - Intronic
1034207525 7:149330674-149330696 CTAAATATTGAGAAGAAATAAGG - Intergenic
1034239166 7:149596630-149596652 GAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1036292166 8:7503441-7503463 ATCAAAAAAGAGAAGGAATAGGG - Intronic
1036663029 8:10720647-10720669 TGAAATAAAGAGAAAGAAAAAGG + Intergenic
1036764057 8:11535315-11535337 AGAAAGAAAGAGAAGGAAAAGGG + Intronic
1036926723 8:12914193-12914215 ATAAATAAAGAGAAAAAATATGG + Intergenic
1037099578 8:15027770-15027792 TTAAAGAAAGAGAAGGGAGAGGG + Intronic
1037265252 8:17051885-17051907 CTAAATAGAGAGGAGGGACAGGG + Intronic
1037334576 8:17779804-17779826 GTGAAGGAAGAGAAGGAATAAGG - Intronic
1037578302 8:20228649-20228671 CCATGTAAAAAGAAGGAATAAGG + Intergenic
1039816570 8:41099993-41100015 ATAAATAAAAAGAAGGAAGAAGG - Intergenic
1040033280 8:42845025-42845047 CTATATAAAGAAAAGGAGCAGGG - Intergenic
1040963283 8:53058250-53058272 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1041473617 8:58238593-58238615 CTGAACAAAGAGAAAGAAAATGG + Intergenic
1041481481 8:58324831-58324853 CTACAAAAAGAGAAGGAAATGGG + Intergenic
1041625348 8:60019640-60019662 CTAACCACAGAGATGGAATAAGG - Intergenic
1042596689 8:70456259-70456281 CTAAAGCAAGAAAAAGAATAAGG + Intergenic
1042730264 8:71925753-71925775 GTAAATAAAGATAGGTAATATGG - Intronic
1043084786 8:75815769-75815791 CTTAATACAGAGAAGAAATTTGG - Intergenic
1043207766 8:77468856-77468878 ATAAATAAATAAAAGAAATAAGG - Intergenic
1043262694 8:78221551-78221573 GTAAAGAAAAAGAAGGAATGTGG + Intergenic
1043746739 8:83882263-83882285 ATAAATAAAGAGTGAGAATAAGG + Intergenic
1044327339 8:90874639-90874661 TTAAATAAAATGAAGGAAAAGGG - Intronic
1044554238 8:93544704-93544726 ATAAATAAAAAGAAGGAGTAAGG + Intergenic
1044892471 8:96851895-96851917 CTGAATAAAGAGAAGGAAGAGGG - Intronic
1044912693 8:97077968-97077990 GTAAATAAAGAGAAAGAATGAGG - Intronic
1044914557 8:97098571-97098593 CTTAATAATAAGCAGGAATATGG - Intronic
1045332313 8:101166032-101166054 CTATAGAAAAAGAAGGAAGAGGG + Intergenic
1045403464 8:101841895-101841917 ATAAAGAAAAAGAAAGAATACGG + Intronic
1045815979 8:106276665-106276687 TTAAATAAACAGAAGAAACATGG - Intronic
1046844417 8:118900012-118900034 TAAAATAAAGTGCAGGAATATGG + Intergenic
1046847949 8:118939645-118939667 ATGAAGAAAGAGAAGGAATTTGG + Intronic
1047294987 8:123562720-123562742 CTAGAGAGAGAGAGGGAATAGGG - Intergenic
1051115139 9:13685880-13685902 CTAAATAAATGGAAAGAACAGGG - Intergenic
1051276001 9:15399296-15399318 CTATAGAAAGAAAGGGAATAAGG - Intergenic
1051432819 9:16997887-16997909 TTAAATTAAGAGATGGAGTAAGG - Intergenic
1051686209 9:19660563-19660585 CTAAGTAAAGAGAAAGATTGAGG + Intronic
1051846803 9:21460527-21460549 CTAAATAAACAGAATGAAGGGGG - Intergenic
1052634053 9:31077960-31077982 GGAAATAAAGAAAAGGAACAAGG + Intergenic
1053251208 9:36575170-36575192 CTAAATAAATAGAAGAATTGGGG - Intronic
1053252047 9:36582759-36582781 CTAGAGAAAGAGAAGGGCTAAGG + Intronic
1054969312 9:71066827-71066849 CTAGATAAAAAGAGGGAACAGGG - Intronic
1056451375 9:86720411-86720433 CTAAATAAAGAGTAGATATGGGG + Intergenic
1056783620 9:89571782-89571804 CTAAAAAAAGAAAAAGAACATGG + Intergenic
1057315956 9:93968646-93968668 CTAAATAAACTGAACGAATGAGG + Intergenic
1057602786 9:96473066-96473088 CTACAGAAAGAGAAGGCCTAAGG - Intronic
1057755600 9:97832398-97832420 CTCAGAAAAGAGAAGGCATATGG - Intergenic
1058455968 9:105138479-105138501 CTCAATAAAGAGAAAGAATAGGG - Intergenic
1059127490 9:111705663-111705685 TTCAATAAAGAGAAAAAATAGGG + Intronic
1060311398 9:122465798-122465820 AGAAATAGAGAGAAGGAACAGGG - Intergenic
1060386314 9:123232368-123232390 CTATAGAAATAGATGGAATAGGG - Intronic
1060741499 9:126101008-126101030 GTAAATACAGAGAAAAAATAAGG + Intergenic
1062515917 9:136935653-136935675 CTATAAAAAGAGAAGGAAAAAGG - Intronic
1185954035 X:4469461-4469483 CTGAGTAAAGATAAGGAAGAGGG - Intergenic
1186323419 X:8453566-8453588 AAAAAAAAAGAGAAGGAAGAAGG + Intergenic
1186387670 X:9126396-9126418 CTAACTAAAGACAAGGATGAAGG + Intronic
1186585301 X:10867090-10867112 CTAAATAAAAAGAAAGAACCTGG - Intergenic
1186899344 X:14036974-14036996 AAAAATAAAGTGAATGAATAAGG + Intergenic
1187529753 X:20085668-20085690 AAAGATAAAGAGAAGGAACAGGG + Intronic
1188007990 X:25030297-25030319 CTTAAGAAAGAGAAGGATTCTGG - Intergenic
1189511638 X:41668223-41668245 GAATATAGAGAGAAGGAATAGGG + Intronic
1189601741 X:42634138-42634160 TTGAAGAAAGAGAAGGAAGATGG + Intergenic
1189841503 X:45083765-45083787 CTAAAAAAAGATAATGAAAAGGG - Intronic
1190437296 X:50438100-50438122 CTTAATAAAGGGAAGGAGCAAGG + Intronic
1191058868 X:56273415-56273437 AAAAATAGAGAGAATGAATAAGG - Intronic
1191169930 X:57433706-57433728 GTATAAAAAGAGAAGAAATAAGG - Intronic
1191792967 X:64990695-64990717 ATACAGAAAGAGAAGGAACAGGG - Intronic
1192334467 X:70205798-70205820 GTAAATAAAGAAGAGGAAAAGGG - Intergenic
1193183116 X:78482160-78482182 GTGAAGAAAGAGAAGAAATAAGG - Intergenic
1194081823 X:89476812-89476834 CTAAATAAATAAAATGAATAAGG - Intergenic
1194853672 X:98901361-98901383 GCATATAAAGAGAAGCAATATGG - Intergenic
1195037577 X:100984089-100984111 CAAAAAAAAAAGAAGGAAAATGG - Intronic
1195333089 X:103822079-103822101 CTAAATAAATAGAAAGAAAGTGG + Intergenic
1195389889 X:104350598-104350620 GTCAATAAAGAGAAAGAATTTGG + Intergenic
1197595581 X:128459993-128460015 CTATATAAAATGAAGAAATAGGG - Intergenic
1197801620 X:130355782-130355804 ATAAATAAATAAAAGGTATATGG - Intronic
1198493900 X:137171020-137171042 CTAAGAAGAGAAAAGGAATACGG - Intergenic
1199167865 X:144698922-144698944 CTAGATTAAGAGAAGGATTTTGG - Intergenic
1199408663 X:147493827-147493849 ATAAATATACATAAGGAATAAGG + Intergenic
1200434491 Y:3133002-3133024 CTAAATAAATAAAATGAATAAGG - Intergenic
1201262546 Y:12174323-12174345 CTAAAAAAAAAGAAAGAAAAGGG + Intergenic
1201481925 Y:14448949-14448971 CTAATTAAAGACAAGAAACACGG + Intergenic
1201566747 Y:15373162-15373184 CTAAGTAAAAAGAAGGAAGCTGG + Intergenic
1201964746 Y:19719600-19719622 GTAAGAAAAGAGAAGGAAAAAGG + Intronic
1202599980 Y:26583514-26583536 CTAAACAAATAGAAGCAAAAGGG - Intergenic