ID: 996712218

View in Genome Browser
Species Human (GRCh38)
Location 5:126554524-126554546
Sequence ATCTGGTTCTTTATGGAAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 340
Summary {0: 1, 1: 0, 2: 4, 3: 36, 4: 299}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996712218_996712222 -2 Left 996712218 5:126554524-126554546 CCTTTTTCCATAAAGAACCAGAT 0: 1
1: 0
2: 4
3: 36
4: 299
Right 996712222 5:126554545-126554567 ATGGTAAATATTTTATGCTTTGG 0: 1
1: 6
2: 46
3: 144
4: 540
996712218_996712223 1 Left 996712218 5:126554524-126554546 CCTTTTTCCATAAAGAACCAGAT 0: 1
1: 0
2: 4
3: 36
4: 299
Right 996712223 5:126554548-126554570 GTAAATATTTTATGCTTTGGAGG 0: 1
1: 29
2: 478
3: 1278
4: 2164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996712218 Original CRISPR ATCTGGTTCTTTATGGAAAA AGG (reversed) Intronic
900150214 1:1175355-1175377 ATCAGGTGCTTTTTGGAAACAGG - Intronic
901176054 1:7300129-7300151 ATCTGGTGCTTTATTGCGAAGGG - Intronic
901720766 1:11195406-11195428 ATATGGTTCTTTTTAGCAAAGGG - Exonic
901950726 1:12743816-12743838 ATTTGGTTCTTTATGTCAAAAGG - Intergenic
902546244 1:17192389-17192411 ATTTCGTTCTTTATAGCAAAAGG - Intergenic
903169057 1:21540925-21540947 ATCTGGTTCTCTTTGGAGATGGG + Intronic
903695603 1:25204283-25204305 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
904460718 1:30678182-30678204 GTCTGGTTCTTTTTGCAAAGTGG + Intergenic
905782436 1:40723980-40724002 ATCTGGCCCTTTAAGGAAAAAGG - Intronic
907861502 1:58358076-58358098 ATCTGGATATTTCTGGAAACAGG - Intronic
908996623 1:70163393-70163415 ATCAGATTCTTTTTAGAAAAAGG - Intronic
909034175 1:70578623-70578645 AGCTGGTCCTTAATGGACAAAGG + Intergenic
909999150 1:82321511-82321533 TTTTGGTTCTTTTTGGAAACAGG + Intergenic
910180832 1:84480663-84480685 ATTTGAGGCTTTATGGAAAAAGG + Intronic
910676002 1:89817645-89817667 TTCTGTTTTTTTGTGGAAAAGGG + Intronic
910905005 1:92166085-92166107 ATATTGATCTCTATGGAAAATGG - Intergenic
911975091 1:104482699-104482721 ATTTGGTTCTGTATGGAGGATGG - Intergenic
912089015 1:106047208-106047230 ATCTGGTTGTATATTGGAAATGG - Intergenic
913001863 1:114588632-114588654 ATCAGGTTCTTTTTGGAACTTGG + Intronic
913196662 1:116462329-116462351 TCATGTTTCTTTATGGAAAATGG + Intergenic
914883836 1:151569091-151569113 ATCTGATTCGATGTGGAAAAAGG - Intronic
916127492 1:161584272-161584294 ACTAGCTTCTTTATGGAAAATGG + Intronic
916137410 1:161666076-161666098 ACTAGCTTCTTTATGGAAAATGG + Intronic
917169142 1:172150387-172150409 ATCTGATTCTGTGTGGCAAATGG - Intronic
918309587 1:183276133-183276155 ATCTGGGTGGTTGTGGAAAAAGG - Intronic
918686733 1:187426376-187426398 ATCTGCTATTTTATGTAAAATGG - Intergenic
919057371 1:192587885-192587907 ATGTGGTCCTTTAGGGAAACTGG - Intergenic
919495523 1:198261973-198261995 AATTGGTTCTTTGTGGAGAAGGG - Intronic
920838382 1:209533297-209533319 ATGTGGTTCTATTTGGAAATTGG - Intergenic
921135462 1:212255633-212255655 ATCAGGTTTTATATGGGAAAGGG - Intergenic
923646075 1:235821633-235821655 ATCTGGTTCTTTATATAAAAAGG - Intronic
923760951 1:236843549-236843571 CTCTGGTTCTTTGTGGAGAATGG + Intronic
924122395 1:240814464-240814486 ATCTGATTCTTAGTGGAACAAGG + Intronic
1063171054 10:3510351-3510373 ATGTGTTGCTTTATGGCAAAAGG + Intergenic
1064936679 10:20686198-20686220 CTCTGATTCTTTATTGAGAAGGG - Intergenic
1067159192 10:43808420-43808442 ATCTGGTTCTTAAAAGGAAATGG - Intergenic
1067715762 10:48690268-48690290 GTCTGATACTTTAAGGAAAAGGG + Intronic
1067817629 10:49494526-49494548 ATCTGATTCTTCAGGAAAAAGGG - Intronic
1068941299 10:62683744-62683766 ATTTGTTTCTTTATAGACAAAGG - Intergenic
1069533005 10:69232748-69232770 ATTTGTTTCTTAATAGAAAATGG + Exonic
1070024845 10:72622752-72622774 ATATGCTTATTTTTGGAAAATGG - Intronic
1071470506 10:85980800-85980822 ATCTGCTTCTTAATAGAAACAGG + Intronic
1071737324 10:88316457-88316479 ATGTGGTACTGTATGGAAGAGGG - Intronic
1071833654 10:89397010-89397032 ATTTGGTTCTTTATAAAATAGGG + Intronic
1072111943 10:92330504-92330526 TCCTGGATCTTTAAGGAAAAGGG + Intronic
1072332390 10:94366369-94366391 AACTGTTTGTTTATAGAAAATGG - Intergenic
1072822863 10:98575309-98575331 ATGTGGTGCTGTGTGGAAAATGG - Intronic
1074036598 10:109745395-109745417 GTCTGGTTCTTTATAGCAAGTGG - Intergenic
1074748673 10:116561772-116561794 TTCTGTTTCTTTAGGGAAAAGGG + Intronic
1075519673 10:123136138-123136160 AGCAGGTTCTTGATGGAGAACGG - Exonic
1075751907 10:124779438-124779460 TTCTGTTTCTTTATAGAAAATGG - Intronic
1079803592 11:24901198-24901220 ATCTAGTTGTTTATGGCAAGAGG + Intronic
1080359915 11:31500908-31500930 ATTTGGTCTTTTATAGAAAAAGG + Intronic
1081028648 11:38049003-38049025 ATCTGGCCCTTTAGAGAAAATGG + Intergenic
1083904723 11:65662377-65662399 ACCTGCTTCTTGAGGGAAAACGG + Intronic
1086669119 11:89525996-89526018 ATATGGTTAATTTTGGAAAAAGG - Intergenic
1086841221 11:91687097-91687119 ATCTGGCCCTTTATTGGAAATGG + Intergenic
1087622034 11:100553805-100553827 ATTTGGCTCTTTATGTTAAAAGG - Intergenic
1090846863 11:130536684-130536706 TTCTGGATCTTTTTGGAAGATGG + Intergenic
1090900645 11:131027710-131027732 ATCTTTTTCTTTCTGGACAAGGG + Intergenic
1091611331 12:2012486-2012508 ATCTAGTCCTTTACAGAAAAAGG + Intronic
1092011384 12:5115571-5115593 ATGTGGGTGTGTATGGAAAAGGG + Intergenic
1092446090 12:8558917-8558939 ATCAGTGTCATTATGGAAAACGG + Intergenic
1092755092 12:11755873-11755895 ATCTGGTAATCAATGGAAAATGG - Intronic
1092887059 12:12934084-12934106 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
1093385231 12:18544987-18545009 TTGTGGTTATGTATGGAAAATGG - Intronic
1093708270 12:22299433-22299455 GTCTGGTTGTTTATGAAAGAGGG + Intronic
1093749222 12:22779464-22779486 ATCTGTTTCTTCCTGGACAATGG - Intergenic
1094111625 12:26868771-26868793 ATCAGGTTCTATATGTCAAAAGG + Intergenic
1095412723 12:41941926-41941948 ACCTGGTTCTTTATCCATAAGGG - Intergenic
1095583439 12:43825574-43825596 ATCACGTTCTTTATGTCAAAGGG - Intergenic
1096165075 12:49415713-49415735 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1097459375 12:59841977-59841999 ATTCGGGCCTTTATGGAAAAAGG - Intergenic
1098067343 12:66632534-66632556 ATTTGGTTCTCACTGGAAAAAGG - Intronic
1098083396 12:66813898-66813920 TTCTGGTTGTTTATGGAAAATGG + Intergenic
1098360400 12:69648849-69648871 ATTTGGTACTTTATGTAGAAAGG - Intronic
1100303648 12:93330626-93330648 AGCTGGTTCTTTACAGAAAAAGG + Intergenic
1102593076 12:113972040-113972062 ATGTGACTCTTTTTGGAAAAAGG - Intergenic
1103877270 12:124137941-124137963 ATCTAGTTCTTTAGGTAAGAAGG - Intronic
1104326493 12:127803629-127803651 CCCTGGTTCTTTCTGGAAAGTGG - Intergenic
1104538394 12:129640185-129640207 ATCTGGCTCTTTCCAGAAAAAGG - Intronic
1106061751 13:26299845-26299867 ATCTGGCCCTTTACAGAAAAGGG - Intronic
1106543032 13:30706893-30706915 ATTTGGCTCTTTATGTTAAAAGG + Intergenic
1107377811 13:39823369-39823391 ATTTTCTTCTTTCTGGAAAAGGG - Intergenic
1107802349 13:44120559-44120581 ATATCCTACTTTATGGAAAATGG - Intergenic
1109058668 13:57583952-57583974 ATCTGTTTCTTCATAGAACAAGG - Intergenic
1109132484 13:58604803-58604825 ATCAGCTTCTGTATGTAAAAGGG - Intergenic
1109398946 13:61798980-61799002 CTCTGGTTATTGTTGGAAAATGG - Intergenic
1112146674 13:96707818-96707840 GCCTGGCTCTCTATGGAAAAAGG - Intronic
1112604348 13:100889501-100889523 ATCTTGTACTTGATTGAAAAAGG + Intergenic
1112847309 13:103659661-103659683 ACATGGTTCCTTTTGGAAAATGG - Intergenic
1112943215 13:104892187-104892209 ATTTGGTTCTGTTTGGAAATTGG - Intergenic
1113356700 13:109587995-109588017 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1114660010 14:24338094-24338116 ATCTGCTTCATCATGGAAAGAGG + Intronic
1115448138 14:33515621-33515643 ATCTGGTCCTTTACAGGAAAAGG + Intronic
1115464277 14:33697570-33697592 ATCTAGTTATTTTTGGAGAATGG - Intronic
1115503660 14:34072992-34073014 ATCTGCTTATTTTTGCAAAAGGG + Intronic
1116706186 14:48304646-48304668 ATTTGGTTCTTTATGTCAAAAGG + Intergenic
1118334608 14:64842312-64842334 CTCTGGCTCTTTCTGGAAACTGG - Intronic
1118611966 14:67548363-67548385 ATCTGCTTCTTTATGCCAAAAGG + Intronic
1118676393 14:68189341-68189363 GTCTATTTCTTTATGGAAAGGGG + Intronic
1118914281 14:70088845-70088867 ATCTGGTTCCTGATTGGAAATGG - Intronic
1119417413 14:74482326-74482348 CTCTTTTTCTTCATGGAAAAAGG + Intronic
1119611166 14:76063645-76063667 TTCTAGTTGTTTATGGCAAAAGG + Intronic
1119911526 14:78353842-78353864 TTCTGGTTCCTCATAGAAAAAGG + Intronic
1122050097 14:99052339-99052361 ATCTGGTCCTCTACAGAAAATGG - Intergenic
1122147037 14:99697628-99697650 TTCTGGTTGTTTATGGCACAAGG + Intronic
1122446687 14:101774833-101774855 ATCTGGCCCTTTACAGAAAAAGG - Intronic
1124032260 15:26022354-26022376 ATTTGGGTCTTTATGTCAAAAGG + Intergenic
1126031379 15:44502475-44502497 AACTGGCCCTTTATAGAAAAAGG - Intronic
1127029167 15:54842619-54842641 TTCTTGGTCTTTATGTAAAATGG - Intergenic
1127096027 15:55513107-55513129 ATGTGGCTCTTTTGGGAAAAAGG - Intergenic
1128668791 15:69558737-69558759 ATCTGGTTAAGTAAGGAAAATGG - Intergenic
1129500055 15:76027186-76027208 ATGTGAGTCTTTATGGATAAAGG - Intronic
1130449214 15:84034113-84034135 ATCTGGTGGTTTATGGATGAGGG + Intronic
1131334859 15:91539104-91539126 ATCTGGCCCTTTACAGAAAATGG + Intergenic
1132633118 16:929299-929321 ACCTGGTTCTGTATGGAGAGCGG - Intronic
1136123901 16:28162415-28162437 ATCAAGTTCTCTATGGAAGAGGG + Intronic
1136612330 16:31373747-31373769 ATCTAGCCCTTTATAGAAAAAGG - Intronic
1136922033 16:34341054-34341076 ATCTAGTTCTCTTTGGCAAATGG + Intergenic
1136982540 16:35070752-35070774 ATCTAGTTCTCTTTGGCAAATGG - Intergenic
1137506766 16:49060725-49060747 ATGGGGTTCCTAATGGAAAATGG + Intergenic
1138227333 16:55308236-55308258 AACTTGTGCTTTATGGAAAGGGG - Intergenic
1138364594 16:56463981-56464003 ATTTGGTCCTTTATAGCAAAAGG + Intronic
1138367551 16:56493517-56493539 AACTGGTTATTTATAGTAAAAGG + Intronic
1139398921 16:66664313-66664335 ATGAGGTTCTTCATGGAGAATGG + Intronic
1140527362 16:75634131-75634153 TTCTGCTTCTTTAAGGGAAAAGG + Intronic
1140685795 16:77433396-77433418 ATTCGGTTCTTGATGGAAGAAGG + Intronic
1141055565 16:80810636-80810658 CTCTGCTTCTTTATAGCAAAAGG - Intergenic
1144114218 17:12070798-12070820 ATCTGGTTCTTTACAGAAAAAGG + Intronic
1146358597 17:32156047-32156069 ATGTAGTTATTTAAGGAAAAAGG + Intronic
1148761481 17:50004201-50004223 AGCTGTTTGTTTATGGAACAGGG + Intergenic
1149059168 17:52401532-52401554 AGGTGGTTCTTTATGGGGAAAGG - Intergenic
1150986306 17:70201154-70201176 CTCAGTTTCTTTATGCAAAATGG - Intergenic
1151184988 17:72357348-72357370 TTCTGGTTGGTTTTGGAAAATGG - Intergenic
1151997534 17:77619420-77619442 ATCTGGTAACTCATGGAAAATGG + Intergenic
1153408190 18:4764095-4764117 TGCTGTTACTTTATGGAAAATGG - Intergenic
1154027184 18:10719032-10719054 ATGAGGTTCTTTATAGAAAATGG + Intronic
1154063245 18:11083286-11083308 TTGTGGTTCTTTATGAAAAGAGG + Intronic
1156891973 18:42201029-42201051 TTATGGTTCTTTATGCCAAAAGG + Intergenic
1157851283 18:51053763-51053785 TGCTGGTTCTTAATGAAAAAGGG + Intronic
1158978380 18:62734312-62734334 CTCTGGATCTTCATGGAAGAAGG + Intronic
1159839654 18:73383893-73383915 AACTGGTGATTTATGGAAAGGGG + Intergenic
1161909716 19:7184108-7184130 ATCTGGTCCTTTAGAGAAAAAGG + Intronic
1162265153 19:9567063-9567085 CTCTGTGACTTTATGGAAAATGG - Exonic
1162878642 19:13640115-13640137 TTCTGGTCCTTTATATAAAAAGG - Intergenic
1164549112 19:29193456-29193478 ATCACATTCTTTAAGGAAAAGGG - Intergenic
1164772556 19:30821588-30821610 ATCTGGTTCTCAAAGGAAATAGG + Intergenic
1166527655 19:43522929-43522951 ATCTGGTCCTTCACAGAAAAAGG + Intronic
925391903 2:3500869-3500891 ATCCGGATCTTCATGGAGAAGGG - Exonic
928071809 2:28224640-28224662 GTTTGCTTCTTTATGGTAAATGG - Intronic
928244667 2:29616840-29616862 ATTTGGCTCTTTAGGGCAAAAGG - Intronic
930062399 2:47301046-47301068 ATTTGGTGCTTTATGTGAAAAGG + Intergenic
930934600 2:56932435-56932457 ATTTGGTTTTTTGTGGAGAAGGG + Intergenic
931258364 2:60595094-60595116 ACCTGGTTCTTTACGAAAAGAGG - Intergenic
931342479 2:61414874-61414896 ATCTGATTGGTTATGGAAAGTGG + Intronic
933112440 2:78420700-78420722 ATGTGGTTGTTTTTGGAAATAGG - Intergenic
935016545 2:99187939-99187961 ATCTGGTCCTTTACAGAAAACGG + Intronic
935430713 2:102972964-102972986 ATCTGGTTCCTGATAGAATAGGG + Intergenic
936966611 2:118133482-118133504 ACCTTGTTCTTTATTGAAAAGGG + Intergenic
937554962 2:123142711-123142733 AGCTTATTCCTTATGGAAAATGG + Intergenic
939385054 2:141485491-141485513 TTGTTGTTCTTTCTGGAAAATGG + Intronic
939399132 2:141668696-141668718 ATCTGATTCTTCCTGGAAGATGG + Intronic
939867994 2:147496053-147496075 ATGTTGTTTTTTAGGGAAAATGG + Intergenic
941618498 2:167750948-167750970 ATCTGGCCCTTTATAGAAAAAGG - Intergenic
941641106 2:167989407-167989429 AACTGGTTCTTTGGAGAAAATGG - Intronic
941837717 2:170044572-170044594 ATTTAGTTCTTTATGTACAAGGG + Intronic
943115794 2:183668383-183668405 ATCTGTTTCTTTAAGCATAAGGG - Intergenic
944172321 2:196793615-196793637 ATCAGTTTCTTTTTGCAAAAAGG + Intronic
944203599 2:197134521-197134543 GACTGGTTGTTGATGGAAAATGG + Intronic
946719868 2:222593173-222593195 AACTGGTTCTTAGAGGAAAAGGG + Intronic
947341739 2:229147843-229147865 ATCTGATTCTCTATAGTAAAAGG + Intronic
948034759 2:234849022-234849044 ATCTGGGTCTCTATGGAAAAGGG - Intergenic
948139094 2:235659884-235659906 ATCTGGCTCTTTGTGCACAATGG + Intronic
948585595 2:239016877-239016899 CTCTGGTTCTTTAAGGTCAATGG - Intergenic
1169770841 20:9198419-9198441 TTCTGTTTCTTTGTGGAATATGG + Intronic
1169845850 20:9990720-9990742 CTTTAGTTCTTTATGTAAAATGG - Intronic
1172050484 20:32113483-32113505 GTCTCACTCTTTATGGAAAACGG + Intronic
1174162662 20:48562826-48562848 ATCTGGCTCTTTCTGAAAAAGGG + Intergenic
1174219822 20:48945361-48945383 ATGTGTTCCTTTATGGAAAAAGG + Intronic
1174952148 20:55054040-55054062 ATCTGGTTCTTTGTGGTTACAGG + Intergenic
1175013927 20:55768015-55768037 ATTTGGTTCTTCACAGAAAAGGG + Intergenic
1175416029 20:58801637-58801659 ATCTGTTCATTTATGGAAATGGG - Intergenic
1181349740 22:22246372-22246394 ACCTGGCTCTTTATAGAAAATGG - Intergenic
1181420737 22:22796442-22796464 ATTTGGTGATTTATGGGAAATGG - Intronic
1181487746 22:23242166-23242188 TTATTGTTCTTTATCGAAAAAGG - Intronic
1182024849 22:27110150-27110172 ATCTGGCTCTTGGTGGCAAAAGG + Intergenic
1184072937 22:42157269-42157291 CTCAGGTTCCTTATGTAAAATGG + Intergenic
949583969 3:5419143-5419165 ATCTGGACCTCTAAGGAAAAGGG + Intergenic
950159367 3:10748095-10748117 ATCTGGCTCTTTACAGAAAAAGG - Intergenic
953854470 3:46490220-46490242 ATCTGGCTCTTTACAGAAAGAGG - Intergenic
953981527 3:47415636-47415658 CCTTGTTTCTTTATGGAAAAAGG - Intronic
954922092 3:54200057-54200079 ATCTGGCCCTTTATAGGAAAAGG + Intronic
955747328 3:62153160-62153182 CTTTGGTACTTTATAGAAAACGG + Intronic
956069216 3:65429944-65429966 AATTGGTTCTTTATCCAAAATGG + Exonic
956797675 3:72731243-72731265 ATCTGGACCTTTACAGAAAAAGG - Intergenic
956798412 3:72736348-72736370 ATCTGGACCTTTACAGAAAAAGG - Intergenic
957520850 3:81316332-81316354 ATCTGGTTCTAGATGGAAACTGG + Intergenic
957608615 3:82437329-82437351 ATCTGGCACTTTACAGAAAAAGG - Intergenic
957962098 3:87269354-87269376 GTCTGGTTCTTTACAGAAAAGGG + Intronic
958724529 3:97888272-97888294 GTCTGGTTCTGTAAGTAAAAAGG - Intronic
959133224 3:102384433-102384455 ATCAGGTTCTTAATGGACAAGGG + Intronic
960094068 3:113671216-113671238 AGCTGCCTCTTTATGGCAAATGG + Intronic
960857211 3:122114359-122114381 TTCTAGTTGTTTATGGAAAGAGG - Intronic
961234930 3:125357761-125357783 AACTGGTTCTTTAAGGAAAGGGG - Intronic
961437306 3:126928195-126928217 ATCTGGTTCTTATTGGACCAGGG + Intronic
961800224 3:129442045-129442067 ATCTGGGTTTTTATGTGAAATGG + Intronic
963250250 3:143096157-143096179 ATCTCATTCTTCATGGACAAGGG + Intergenic
966284464 3:178277566-178277588 ATCTGGTGTTTTACAGAAAAAGG - Intergenic
967313279 3:188126729-188126751 ATCTTGCTCTTTATGCAGAAAGG - Intergenic
969324835 4:6436669-6436691 CTCTGGACCTTTATGGAAAAAGG - Intronic
969644447 4:8419126-8419148 ATCTGGTTCTTTAAGAGATAAGG - Intronic
971638560 4:29098038-29098060 CTCTTGTTCTTTACAGAAAAGGG + Intergenic
972354529 4:38268007-38268029 TTGTGGTTCTTTAATGAAAATGG + Intergenic
972725476 4:41743557-41743579 ATCAGGTGCTATATGGAACAGGG - Intergenic
973277888 4:48328615-48328637 ATCTGTTTCTTTCTGAAAATTGG - Intergenic
973765219 4:54156047-54156069 AGCTGGTTGTTTAAGGAAACTGG - Intronic
975604652 4:76142120-76142142 ATTTGGTTTTTTTAGGAAAATGG - Intronic
975939661 4:79627595-79627617 ATGTGTTTCTTTCTAGAAAAAGG + Intergenic
977613967 4:99066584-99066606 TTCTGGTTATTTTTGAAAAAAGG + Intergenic
977809559 4:101345216-101345238 ATTTTGTTCTTTCTGAAAAAAGG + Intronic
978101476 4:104846714-104846736 TTCTGGTTGTTTATCAAAAATGG - Intergenic
978624635 4:110670636-110670658 TTCTGTTTCTTTGAGGAAAAAGG + Intergenic
978653342 4:111035384-111035406 ATCTGGTTCTTCCCTGAAAAAGG + Intergenic
979169147 4:117577622-117577644 ATCTAGCTCTTTATTTAAAAGGG + Intergenic
979990584 4:127370517-127370539 ATGTGTTTCTTTAATGAAAATGG - Intergenic
980306015 4:131062488-131062510 ATATGTTTATTAATGGAAAAGGG - Intergenic
980486499 4:133463506-133463528 TTCTGTTTCTCTATGAAAAATGG + Intergenic
981781914 4:148440769-148440791 AAGTACTTCTTTATGGAAAAGGG - Intronic
982080392 4:151783949-151783971 ATTTGGCTCTTTATGTCAAAAGG + Intergenic
982942637 4:161577369-161577391 TTCTGTTTATTTATGGCAAATGG - Intronic
984400145 4:179253112-179253134 ATCTGGTACTTTAATGAAAGAGG + Intergenic
986434664 5:7717142-7717164 ACTTGGTTCTATATGAAAAATGG - Exonic
986703183 5:10431504-10431526 ATCTGTTCCTTTATGCAGAAAGG + Intronic
987861260 5:23491241-23491263 GTTTGGTTCTTTCTGAAAAATGG + Intergenic
988430778 5:31116228-31116250 ATATGGTTCTTATTGGAAAGTGG - Intergenic
989120534 5:38000163-38000185 CTCTGGCTGTTTATGGAAAAAGG + Intergenic
990880605 5:60533414-60533436 ATCTGGTTCCCTCTGGGAAAAGG - Intergenic
991187235 5:63824046-63824068 ATCTGGATCTTTCTTGAAAGAGG + Intergenic
992114439 5:73526082-73526104 ATTTGTTTGTTAATGGAAAATGG + Intergenic
992259808 5:74958383-74958405 ATATGGTTCTTTGTGTAACATGG - Intergenic
992536587 5:77711321-77711343 ATCTGGTCCTTTACAAAAAAGGG + Intronic
993405287 5:87504582-87504604 ATCTGTTTCTTTATGGATCATGG + Intergenic
993557657 5:89361619-89361641 ATTTGGCTCTTTACAGAAAAGGG + Intergenic
993559632 5:89389544-89389566 ATCAGTTTCTTGATGGACAAAGG + Intergenic
995432450 5:112096241-112096263 AACTGATTCTTTATTGAAAGAGG + Intergenic
996389299 5:122942518-122942540 TTCTGCTTCTTTGTGGAAAATGG + Intronic
996712218 5:126554524-126554546 ATCTGGTTCTTTATGGAAAAAGG - Intronic
996739664 5:126787334-126787356 ATTTGCTTCTAAATGGAAAATGG + Intronic
996852714 5:127970497-127970519 ATTTGGTTCTCTATAGAAAAAGG - Intergenic
999139767 5:149351631-149351653 ATCTTGTATTTTGTGGAAAAAGG + Exonic
1000428042 5:161115935-161115957 ATTTCTTTCTTTTTGGAAAATGG - Intergenic
1000886523 5:166753970-166753992 ATCTGGCCCTCTATAGAAAAAGG - Intergenic
1002358102 5:178647335-178647357 CTCAGGTTCTTTATGGTATAAGG - Intergenic
1003379663 6:5611936-5611958 CTTTTGTTCCTTATGGAAAATGG - Intronic
1004125747 6:12871469-12871491 ATGTGGTTTGTTATGGAAAATGG + Intronic
1004987985 6:21104449-21104471 ATCTGGCCCTTTATAGAGAAAGG - Intronic
1005075770 6:21905393-21905415 ATCAGGTGCTTTAGGTAAAAGGG - Intergenic
1005655442 6:27930685-27930707 TTCTTATTCTTTATGAAAAATGG + Intergenic
1008103994 6:47423500-47423522 ATCTGGTTCTTTATGGTTATTGG + Intergenic
1008334719 6:50288449-50288471 ATCTGGTGATTGATGGAACAGGG + Intergenic
1009698970 6:67149772-67149794 ATCTGAAACTTTATGGAGAATGG + Intergenic
1009782715 6:68291612-68291634 ATCTGGTTCTTCAAGTCAAAGGG - Intergenic
1009868633 6:69429445-69429467 ATGTGGTTCTTTAGAAAAAAGGG + Intergenic
1011087672 6:83560499-83560521 ATTTGTTTCTTTATGAAAGATGG + Intronic
1011666113 6:89635954-89635976 ATCTAGATCTTTGTTGAAAAGGG - Exonic
1012440686 6:99259653-99259675 ATCTTGTTCTTTTTTGAAGACGG - Intergenic
1013200903 6:107894999-107895021 ATCTGGATGTTTAAAGAAAAAGG + Intronic
1014030055 6:116690789-116690811 CTCAGGTCCTTTATGTAAAATGG + Intronic
1014106428 6:117568610-117568632 ATCTGTCTCTTTCTGCAAAATGG - Intronic
1014203995 6:118635985-118636007 ATCTGGCTCTTGACAGAAAAAGG - Intronic
1014344890 6:120255758-120255780 ATCTGTTTCTCTAGGGAGAATGG - Intergenic
1016295141 6:142565742-142565764 ATCTCTTTCTTTAAGAAAAAAGG + Intergenic
1016736730 6:147487739-147487761 ATCTGGTCTTTTACAGAAAAAGG + Intergenic
1017402496 6:154079991-154080013 ATCATATTCTATATGGAAAAGGG + Intronic
1017797556 6:157860101-157860123 ATCTGGTCCTGTACAGAAAAAGG + Intronic
1018379834 6:163248717-163248739 ATGTGCTTCTTTCTAGAAAAAGG + Intronic
1018858313 6:167691314-167691336 ATCTGGTGCTTTATTTAAACCGG - Intergenic
1020886335 7:13823057-13823079 ATGTGTTTCTATTTGGAAAAGGG - Intergenic
1021417277 7:20402471-20402493 ATCTGATTCATTCTGGTAAATGG + Intronic
1021812719 7:24419031-24419053 ATCTGGATCTTTATGTGAGAGGG - Intergenic
1022030387 7:26487193-26487215 ATTTTGTTCTTTTTGGGAAACGG - Intergenic
1022528994 7:31055399-31055421 ATCTGGCACTTTACAGAAAAAGG - Intronic
1022603964 7:31790145-31790167 ATATGGGTCTTTGTGGAAGAAGG + Intronic
1023255683 7:38310327-38310349 ATTTGGTCCTTTAAAGAAAAAGG - Intergenic
1023535557 7:41205321-41205343 CTCTGGCTCTTTACAGAAAAAGG - Intergenic
1023622065 7:42083587-42083609 ATCTTATCCTTTATGGAAAAAGG + Intronic
1028169817 7:87582588-87582610 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1028535267 7:91884646-91884668 ATTTGGTCCTTTATAGGAAAAGG - Intergenic
1028785117 7:94783878-94783900 ATCTTGTATTTTGTGGAAAAAGG + Intergenic
1029901133 7:104041090-104041112 ATCTAGTTTTATGTGGAAAAAGG - Intergenic
1030091636 7:105863403-105863425 AGCTTGTTCTTTAAGCAAAATGG - Intronic
1030963231 7:115953269-115953291 CTCTGGGTCTTTATGAAGAATGG + Intronic
1031063845 7:117082706-117082728 GTCTGGCTCTTTACAGAAAAGGG - Intronic
1031160407 7:118160764-118160786 ATCTTGTTTTTTTGGGAAAAAGG - Intergenic
1031760561 7:125708204-125708226 CTATTGTTCTTTATGGAACAGGG - Intergenic
1032091149 7:128912281-128912303 CTCTGATTCTTTCTGTAAAATGG - Intergenic
1032143156 7:129352787-129352809 ATCTGCTGCTGTGTGGAAAATGG - Intronic
1034360124 7:150488600-150488622 TTCTGGTTGTTTATGGAAGGAGG - Intergenic
1036968523 8:13328050-13328072 ATCTGGTGAGTGATGGAAAAGGG + Intronic
1037073598 8:14684308-14684330 ATCAAGTTCTTTAGGGAAAGTGG + Intronic
1037476188 8:19259988-19260010 ATCTGCTGCTTTATTTAAAAAGG + Intergenic
1039187200 8:34930755-34930777 TTTTGGATCTTTATGGCAAAAGG - Intergenic
1039294476 8:36134518-36134540 ATCTGTTTCTTTATGAATAAGGG + Intergenic
1039337022 8:36602526-36602548 ATATGGCTCTTTATGTCAAAAGG - Intergenic
1039339917 8:36636575-36636597 AACTGGATCTTAATGGACAAAGG + Intergenic
1040911016 8:52519183-52519205 ATTTGGTTGCTTTTGGAAAAGGG - Intergenic
1041142513 8:54837745-54837767 GTCTGGTCCTTTACAGAAAAAGG - Intergenic
1041451517 8:58011456-58011478 ATTTGGCTCTTTATGTCAAAAGG - Intronic
1043570578 8:81598439-81598461 AGCTGGTCCTTTATGTGAAAAGG + Intergenic
1043838649 8:85075069-85075091 ATCTATGTTTTTATGGAAAATGG - Intergenic
1045113833 8:98960486-98960508 ATCTGATTCTTTTTTGAAAACGG - Intergenic
1045828859 8:106433499-106433521 AAGTGGGTCTTTTTGGAAAAGGG + Intronic
1045852593 8:106720549-106720571 ATTTGGTTCACTATGGAAAAAGG + Intronic
1048337439 8:133513587-133513609 ATCTGATTCTTTCTAGAAAAAGG + Intronic
1050235079 9:3569349-3569371 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1051966671 9:22836349-22836371 TGCTGGTTCTTCAGGGAAAAAGG + Intergenic
1052671169 9:31559445-31559467 ATCTGGTTTTGAAAGGAAAATGG + Intergenic
1054838869 9:69713462-69713484 ATCTGTTTGTATATGGAGAAGGG - Intronic
1054944251 9:70778161-70778183 ATCCAGTTTTTGATGGAAAAGGG + Intronic
1055142836 9:72895796-72895818 ATCTGGTTTATCATGGAGAATGG + Intergenic
1057116037 9:92523292-92523314 ATCTGGCCCTTTATAGAAAAAGG - Intronic
1058078444 9:100674701-100674723 ATCTTTTTTTTTTTGGAAAAAGG + Intergenic
1058297353 9:103326083-103326105 ATCTGTTTCATTATATAAAAGGG + Intergenic
1058548215 9:106084122-106084144 ATCTGGCCCTTTACAGAAAAAGG + Intergenic
1059003350 9:110374296-110374318 ATCATGTTCTTTGTGGAATATGG - Intronic
1060033322 9:120234102-120234124 CTCTAGTGCTTTATGGTAAAGGG - Intergenic
1186560000 X:10601553-10601575 GTCTGGTCCTTTATGAACAAGGG + Intronic
1186879155 X:13847527-13847549 ATCCATTTCTTTATAGAAAATGG + Intronic
1187534118 X:20122643-20122665 ATCTGGTCCTTTGTAGAAAGGGG - Intergenic
1187640106 X:21277996-21278018 GTTTGGTTCTTTCTGAAAAATGG - Intergenic
1187811797 X:23187327-23187349 AACTGTTTTTTTATGTAAAATGG - Intergenic
1190844382 X:54178050-54178072 ATCTGCTTCTTTAAGAATAATGG + Intronic
1195009267 X:100719420-100719442 ATATGGTGATTTTTGGAAAAGGG + Intronic
1196001619 X:110793433-110793455 ATTTGGTTCTTTAAGGAGCAGGG - Intronic
1197610356 X:128631446-128631468 ATCTGGCCCTTTACAGAAAAAGG - Intergenic
1198217873 X:134573355-134573377 CTCTGGGGCTTTGTGGAAAAGGG - Intronic
1199116853 X:144002551-144002573 AGTTGGTTCTTTATGTCAAAAGG + Intergenic
1201268980 Y:12236146-12236168 ATTTGGTTCTTTATGTGAAGAGG - Intergenic
1202020175 Y:20456398-20456420 ACGTGGTTCTTTGAGGAAAACGG + Intergenic