ID: 996714921

View in Genome Browser
Species Human (GRCh38)
Location 5:126579400-126579422
Sequence GGGAGTAAACGGTAGGATGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 180}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996714921_996714927 -2 Left 996714921 5:126579400-126579422 CCACCATCCTACCGTTTACTCCC 0: 1
1: 0
2: 0
3: 9
4: 180
Right 996714927 5:126579421-126579443 CCTCATATTACTTACCATGCTGG No data
996714921_996714928 8 Left 996714921 5:126579400-126579422 CCACCATCCTACCGTTTACTCCC 0: 1
1: 0
2: 0
3: 9
4: 180
Right 996714928 5:126579431-126579453 CTTACCATGCTGGATTATGCTGG 0: 1
1: 0
2: 0
3: 7
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996714921 Original CRISPR GGGAGTAAACGGTAGGATGG TGG (reversed) Intronic
900166233 1:1245252-1245274 GGGAGGAGAGGGTAGGGTGGGGG - Intronic
904833123 1:33318386-33318408 GAGAGTGAATGGCAGGATGGGGG - Intronic
905752770 1:40479994-40480016 AGGAGTAAATAGAAGGATGGAGG + Intronic
906651387 1:47515489-47515511 AGGAGAAAAGGGAAGGATGGTGG + Intergenic
911575132 1:99567151-99567173 TGGATTAAACAGTAGAATGGAGG + Intergenic
912156682 1:106929791-106929813 GGCAGTAAAGGAGAGGATGGCGG - Intergenic
912227741 1:107754699-107754721 GAGAGTGAAGGGAAGGATGGTGG - Intronic
913044453 1:115062099-115062121 GGGGGTAAATGGTGGGGTGGGGG - Intronic
914875555 1:151511041-151511063 TGGAGTAAACGGGAGGCAGGAGG + Intronic
915366808 1:155321344-155321366 GGGAGTAAGGGGTAGGCTGGAGG + Intronic
915376378 1:155399858-155399880 AGGAGAAAAGTGTAGGATGGAGG + Intronic
917979438 1:180259939-180259961 GGGAGTGAGCGGTGGGAGGGAGG + Intronic
918365928 1:183807561-183807583 GGGAGTTTAAGGCAGGATGGTGG + Intronic
920663232 1:207937464-207937486 GAGAGTAAATGGTATAATGGAGG - Intergenic
922065104 1:222129716-222129738 TGAAGTAAAGGGTAGAATGGTGG + Intergenic
923052161 1:230396424-230396446 GAGAGTGAAAGGGAGGATGGTGG - Intronic
924845622 1:247767184-247767206 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1064145536 10:12823598-12823620 GGGAGGAAAGAGTGGGATGGAGG + Intronic
1065522941 10:26589614-26589636 GGGGGAAAACGGTGGGAAGGGGG - Intergenic
1065899495 10:30192455-30192477 TGGTGTAAAGGGGAGGATGGGGG - Intergenic
1069893479 10:71666305-71666327 GGGAGTGAGCGGTGGGGTGGAGG - Intronic
1073001858 10:100291695-100291717 GGGAGTAAAGGGGAAGCTGGGGG - Intronic
1073514800 10:104066683-104066705 GGGAGTAACAGGAAGGCTGGAGG + Intronic
1075291583 10:121235890-121235912 GGGTGTTAACCGTAGGATGAAGG - Intergenic
1077571609 11:3343926-3343948 GGGGGAAGACAGTAGGATGGAGG + Intronic
1077883203 11:6367055-6367077 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1080864715 11:36183117-36183139 GGACGTAGACGGTGGGATGGTGG + Intronic
1082666671 11:55983060-55983082 GGAAGTAAAGGGTAGTATTGTGG + Intergenic
1083056984 11:59831840-59831862 GGGAATAAGCGGTAAGATGAAGG + Intronic
1083301206 11:61740419-61740441 GGGAGTTAAGGGTGGGGTGGTGG - Intronic
1085878260 11:80434662-80434684 AGGAGAAAATGGTAGCATGGAGG - Intergenic
1086393665 11:86391936-86391958 AGGAGTAAGAGGGAGGATGGAGG + Intronic
1089038334 11:115420490-115420512 GGGTGGAAACAGCAGGATGGTGG - Intronic
1089826332 11:121281468-121281490 GGGAGTGAACGCTACTATGGAGG - Intergenic
1090601022 11:128371361-128371383 GGGATGAAAGGGTAGCATGGGGG + Intergenic
1091002986 11:131926362-131926384 GGAAGTAAACTGTAGGTTAGGGG + Intronic
1092700471 12:11223646-11223668 AGGAGGAAAGGGTAGGAAGGGGG + Intergenic
1093994485 12:25627061-25627083 GGGAGAAAAAGGTAGCATGATGG - Intronic
1094151467 12:27288841-27288863 GGGAGTAAATGGCAGGGGGGAGG - Intronic
1094475385 12:30836795-30836817 ATGAGTGAACGGTAGGAAGGTGG - Intergenic
1094699678 12:32856816-32856838 GTCAGTGAACGGTAGGAGGGTGG - Intronic
1095959806 12:47827212-47827234 TGGAGAAAACGGTTGGATGAGGG + Intronic
1096067291 12:48751221-48751243 AGGAGGAAAAGGTAGGAAGGAGG - Intergenic
1096562901 12:52449725-52449747 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096565052 12:52471388-52471410 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096567064 12:52490825-52490847 CAGAGTAAACAGAAGGATGGTGG + Intronic
1096985050 12:55750618-55750640 GGGAGTAAAGGGCAAGAGGGCGG + Exonic
1100921508 12:99493568-99493590 TGGAATAAACAGTAGGATGAGGG - Intronic
1101414471 12:104497355-104497377 GGGAGGACACGGCAAGATGGTGG + Intronic
1101615109 12:106328729-106328751 GGAAGTGAATGGAAGGATGGAGG + Intronic
1101708378 12:107242166-107242188 GGGAGGAAATGGTAGGAAGGAGG + Intergenic
1101923175 12:108949660-108949682 GGGAGGAAAAGGTAGGAGAGAGG - Intronic
1105665487 13:22551644-22551666 GGGAGCCAACGGTAGTATGGAGG + Intergenic
1107041298 13:35950898-35950920 GGGAGTAAAGGAGAGGAGGGTGG - Intronic
1108667140 13:52644007-52644029 GGGTGGAAAAGGCAGGATGGAGG - Intergenic
1116475094 14:45331009-45331031 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1118912741 14:70075410-70075432 GGGAGGAAATGGGAGGAGGGTGG + Intronic
1119352556 14:73978223-73978245 GAGAACAAACTGTAGGATGGGGG - Intronic
1120337667 14:83178923-83178945 GAGAGTGAAGGGCAGGATGGGGG + Intergenic
1120913686 14:89690812-89690834 GGGAGTGAAGGGTGGGATGTCGG + Intergenic
1122579458 14:102762406-102762428 GGGAGAATAAGGGAGGATGGTGG + Intergenic
1202918717 14_KI270723v1_random:10780-10802 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1202925907 14_KI270724v1_random:23790-23812 AGAAGTAGACAGTAGGATGGTGG - Intergenic
1124044973 15:26140327-26140349 TGGAGAAAAAGGTGGGATGGGGG + Intergenic
1125131655 15:36290084-36290106 GGGAGTAGAAGGAAGAATGGAGG + Intergenic
1125433301 15:39619900-39619922 GGGAAAAAAGGGTAGGAGGGAGG + Intronic
1126659483 15:51018203-51018225 GGAAGTAAACAGTAGAATTGTGG - Intergenic
1131735262 15:95325355-95325377 GGGAGACAACTGTGGGATGGGGG + Intergenic
1132586191 16:706587-706609 GGGAATAAACTGGAGGCTGGAGG + Intronic
1133778890 16:8921420-8921442 TGGGGTTAAAGGTAGGATGGAGG + Intronic
1135732107 16:24903531-24903553 GGAAGTAGACAGTAGGATAGTGG - Intronic
1135973727 16:27091124-27091146 GGGGGGAAACGGTGGGAAGGGGG + Intergenic
1138044164 16:53703780-53703802 GTGAGTACCCGGGAGGATGGGGG - Intronic
1139602178 16:67993508-67993530 AGGAGTAAAAGGGAGGGTGGAGG - Exonic
1142768334 17:2078717-2078739 AGGAGTAAAAGGAAGGATGGAGG + Intronic
1146741403 17:35287053-35287075 GGGAGGAAAGGGTGGGAAGGGGG - Intergenic
1147776754 17:42907375-42907397 GGGGGTGAACGGATGGATGGGGG + Intronic
1148183941 17:45627796-45627818 TAGAGTATACGGGAGGATGGGGG - Intergenic
1148574700 17:48701559-48701581 TGGACTAAACAGTAGAATGGAGG - Intergenic
1153754967 18:8273266-8273288 GGGAAGAAAAGGTAGGGTGGGGG - Intronic
1154406174 18:14093288-14093310 AGGAGAAAGCGGCAGGATGGAGG - Intronic
1158173752 18:54629899-54629921 GGAGGTACAAGGTAGGATGGAGG - Intergenic
1160965767 19:1746285-1746307 GGGAGGAAGGGGGAGGATGGGGG + Intergenic
1162146006 19:8612322-8612344 GGGAGCAAACAGGAGGGTGGGGG - Intergenic
1164441208 19:28282121-28282143 GGGAGAAGACGGTGGGGTGGGGG - Intergenic
1166076608 19:40417462-40417484 GGGCGTGAACGGTGGGATCGAGG - Intergenic
1167272211 19:48511837-48511859 GGGGGGAGAGGGTAGGATGGGGG + Intronic
1167698794 19:51030262-51030284 GGGAGTAAAAGGGAGGACCGGGG - Intronic
1168357959 19:55713865-55713887 GGGAGGAGAGGGGAGGATGGGGG - Intronic
925822927 2:7818225-7818247 GCGGGTAAAGGGTAGGAAGGCGG + Intergenic
933229854 2:79793978-79794000 GGGAGGAAAGGGTGGGAAGGGGG + Intronic
936805245 2:116323924-116323946 GGAAGTAGACAGTAGAATGGTGG - Intergenic
938266583 2:129932602-129932624 GGGAGTAAAGGGGAGGGGGGTGG + Intergenic
939978334 2:148747297-148747319 AGGAGTAAAAGGTAGTATGGAGG - Intronic
943472114 2:188306958-188306980 GGAGGTAAACAGTAGGATGTAGG + Intronic
944819110 2:203411306-203411328 AGGAGTTACCTGTAGGATGGAGG - Intronic
947752082 2:232538449-232538471 GGGAGAAAACAGGAGGGTGGAGG + Intergenic
948589298 2:239039066-239039088 GGGAGTAACCGGGAGGGTGATGG - Intergenic
1170525757 20:17235336-17235358 GGGAGAAAACTGTAGGATCCTGG + Intronic
1171331123 20:24339747-24339769 GGGAGGAAAAGGGAGGGTGGGGG - Intergenic
1171782697 20:29435476-29435498 AGAAGTAGACAGTAGGATGGTGG + Intergenic
1172842770 20:37912052-37912074 GGGAGTAAATGGGAGGAGGCAGG - Intronic
1172936236 20:38622576-38622598 GGGATTAAAGGGAAGGATGTGGG + Intronic
1173295461 20:41751607-41751629 TGCAGTGAACAGTAGGATGGAGG - Intergenic
1174642530 20:52056854-52056876 GGGAGTAAAGGAAGGGATGGTGG + Intronic
1175034609 20:55988327-55988349 GCAAGTAAACTGTTGGATGGGGG - Intergenic
1175894811 20:62331292-62331314 GGGTGTAGGCGGTACGATGGGGG + Intronic
1178664367 21:34533831-34533853 GGGAGTGAACCGTTGGATGCTGG + Intronic
1178840845 21:36136387-36136409 GGGAGTGAAATGAAGGATGGGGG + Intronic
1181675609 22:24449628-24449650 GGAAGTATGGGGTAGGATGGAGG - Intergenic
949767141 3:7539218-7539240 GGGAATAAATGCTAGGATGAGGG - Intronic
953027472 3:39153338-39153360 GGGAGTGAACGGCAGGAGGCAGG + Intronic
954432934 3:50480880-50480902 GGGAGGAAAGGGGAGGAAGGGGG + Intronic
954432943 3:50480900-50480922 GGGAGGAAAGGGGAGGAAGGGGG + Intronic
956362676 3:68465896-68465918 GGGAGTAAGGGGTGGGATAGGGG + Intronic
957082780 3:75650858-75650880 AGAAGTAGACAGTAGGATGGTGG - Intergenic
959481606 3:106879494-106879516 GGAAGTAGAGAGTAGGATGGTGG + Intergenic
960644153 3:119860017-119860039 GAGAGTGTAGGGTAGGATGGGGG - Intronic
962496427 3:135944919-135944941 GACTGTGAACGGTAGGATGGTGG + Intergenic
969607794 4:8211181-8211203 GGGAGAAAAGGGGAGGAAGGAGG - Intronic
975033290 4:69650849-69650871 GGGGATTAACGGTAGGGTGGAGG + Intronic
975613759 4:76226158-76226180 GGGAGCCAACGCTAGTATGGAGG + Intronic
976328933 4:83805473-83805495 GGGAGTAAATGGGAAGATGTTGG + Intergenic
978183377 4:105829637-105829659 GGGAGGTAACTGTATGATGGGGG - Intronic
979202392 4:117993962-117993984 GGGAAAAAACCCTAGGATGGAGG - Intergenic
981964933 4:150588830-150588852 GGGAGTAAACAGCTGGAGGGTGG + Intronic
982064672 4:151643618-151643640 GGAAGTAAAGAGTAGAATGGTGG - Intronic
988455950 5:31387421-31387443 CGGAGAAAACAGGAGGATGGAGG + Intergenic
990852943 5:60227609-60227631 GGGAGGAAAGGGAAGGAGGGAGG + Intronic
992899158 5:81276047-81276069 GGGAGTAAAGGGTGGGAGGGGGG + Intergenic
993213511 5:84987269-84987291 GGTAGCCAATGGTAGGATGGAGG + Intergenic
994038147 5:95226132-95226154 GGGAGGAAATGGTGGGAAGGGGG - Intronic
994953690 5:106498963-106498985 GGGAGGAAAAGGTATGAAGGGGG - Intergenic
995095090 5:108226358-108226380 AGAAGTAAAAGGTATGATGGAGG - Intronic
996230185 5:121053697-121053719 GGGAAGAAACTGAAGGATGGAGG + Intergenic
996401515 5:123068417-123068439 TGGAGTAAAAGGTAAGATGCAGG + Intergenic
996714921 5:126579400-126579422 GGGAGTAAACGGTAGGATGGTGG - Intronic
996765946 5:127034108-127034130 GGGAGGAAAGGGAAGGAAGGAGG - Intergenic
1001621918 5:173093944-173093966 GAGAGTAAAAAGTAGAATGGAGG - Intronic
1003850991 6:10222402-10222424 GAGAGTAAAGGGCAGGGTGGAGG - Intergenic
1006602109 6:35233068-35233090 GGGAGGAAAAGGGAGTATGGGGG + Intronic
1006879543 6:37327120-37327142 GGGAGTACATGGTGGCATGGGGG + Intronic
1008863231 6:56176896-56176918 GGGAGGAAAGGGGAGGAAGGGGG + Intronic
1008957654 6:57233613-57233635 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1013891560 6:115033166-115033188 GGGAGTAGAGGGAAGAATGGAGG - Intergenic
1015863018 6:137700132-137700154 GGGAGTAAACAGCAGGAAGGAGG + Intergenic
1020080034 7:5282229-5282251 GGGAGAAAAGAGGAGGATGGAGG + Intronic
1021738311 7:23660561-23660583 GGGAGTTAAAGGCAAGATGGGGG - Intergenic
1023053519 7:36273643-36273665 GGGAGGAAAAGGCAGGAGGGAGG - Intronic
1025198882 7:56949987-56950009 GGGAGAAAAGAGGAGGATGGAGG - Intergenic
1025673064 7:63626946-63626968 GGGAGAAAAGAGGAGGATGGAGG + Intergenic
1026771569 7:73204251-73204273 GGGAGTAAACAGAAGGATAAGGG + Intergenic
1026786807 7:73306920-73306942 GGGAGTAAATGATTGGAGGGAGG + Intronic
1027012435 7:74757647-74757669 GGGAGTAAACAGAAGGATAAGGG + Intronic
1027075605 7:75188406-75188428 GGGAGTAAACAGAAGGATAAGGG - Intergenic
1027158083 7:75782528-75782550 GGGAGAAAAAGGAAGAATGGAGG - Intronic
1027916775 7:84334680-84334702 GGTAGTAAAAGGGAGGATTGAGG - Intronic
1028594573 7:92534087-92534109 GGGAGAAAATGGGAGGAAGGAGG + Intronic
1028752063 7:94393624-94393646 GGGAGTGGAGGGTTGGATGGAGG + Intergenic
1031989250 7:128186354-128186376 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1036207786 8:6818010-6818032 GGGAGAAAAAGGGAGGAAGGAGG - Intronic
1036761591 8:11513253-11513275 GGGAGTGGATGGTAGGAAGGGGG + Intronic
1037114474 8:15206887-15206909 TGGAATGAAAGGTAGGATGGAGG + Intronic
1037230003 8:16646682-16646704 TGGAGTAAATGATAGGAAGGAGG + Intergenic
1038085014 8:24186642-24186664 GGGAGTATAGTGTAGGATGATGG - Intergenic
1044473301 8:92597398-92597420 GGGTGCAAACGGTAGGATACTGG - Intergenic
1044658692 8:94574330-94574352 GGGAGTCAACTGGAGGCTGGAGG + Intergenic
1045723499 8:105141863-105141885 GGGACTAAATGGTAGGAAGGTGG + Intronic
1050377283 9:4985684-4985706 GGGACCAAAAGGTAGGAAGGGGG - Intronic
1051234827 9:14988596-14988618 AGAAGTAAAGAGTAGGATGGTGG + Intergenic
1051698090 9:19789873-19789895 GGGAGAGAACAGAAGGATGGAGG - Intergenic
1053654182 9:40198171-40198193 GGGAGAAAACGAAATGATGGTGG + Intergenic
1053904569 9:42827347-42827369 GGGAGAAAACGAAATGATGGTGG + Intergenic
1054366296 9:64344387-64344409 GGGAGAAAACGAAATGATGGTGG + Intergenic
1054530415 9:66178168-66178190 GGGAGAAAACGAAATGATGGTGG - Intergenic
1054673927 9:67834117-67834139 GGGAGAAAACGAAATGATGGTGG + Intergenic
1057187254 9:93063706-93063728 GGAAGTAACTGGTAGGAGGGAGG - Intronic
1057784365 9:98075380-98075402 GGAAGGAAACGGTGGGAGGGAGG + Intronic
1060017762 9:120101702-120101724 GGGAAAAAAGAGTAGGATGGTGG - Intergenic
1061234586 9:129335029-129335051 GGGAGTTAATGGCAGGATGGAGG - Intergenic
1187837012 X:23442219-23442241 GGGTGGAAAGGGTAGGAAGGCGG + Intergenic
1188716607 X:33465980-33466002 GGGAGTAAAATGTGGGGTGGGGG + Intergenic
1192215676 X:69156585-69156607 GGGAGGAAACAGGAGGAAGGGGG + Intergenic
1194319535 X:92427014-92427036 GGGAGTGAAGGGGAGGATAGAGG - Intronic
1196894483 X:120321544-120321566 GGGAGAAAAAGGTTGGGTGGAGG + Intergenic
1197409033 X:126093847-126093869 GGGAGAAAAAGGTAGGCTAGGGG + Intergenic
1198561779 X:137858233-137858255 GGGAGGAAACAGGAGGCTGGGGG + Intergenic
1200627659 Y:5540090-5540112 GGGAGTGAAGGGGAGGATAGAGG - Intronic
1201341119 Y:12935552-12935574 GGGAGGAAAGGGAAGGAGGGAGG - Intergenic
1201628060 Y:16036973-16036995 GAGAACAGACGGTAGGATGGGGG - Intergenic