ID: 996715805

View in Genome Browser
Species Human (GRCh38)
Location 5:126587152-126587174
Sequence CTCATTTTCCCTCCCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 404
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 358}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996715805_996715812 8 Left 996715805 5:126587152-126587174 CCAGAGATGGGAGGGAAAATGAG 0: 1
1: 0
2: 2
3: 43
4: 358
Right 996715812 5:126587183-126587205 GGGATGCAGACGGCAGAAATGGG No data
996715805_996715813 30 Left 996715805 5:126587152-126587174 CCAGAGATGGGAGGGAAAATGAG 0: 1
1: 0
2: 2
3: 43
4: 358
Right 996715813 5:126587205-126587227 GCTACATTCTGTGCTGAAACTGG 0: 1
1: 0
2: 0
3: 6
4: 111
996715805_996715810 -2 Left 996715805 5:126587152-126587174 CCAGAGATGGGAGGGAAAATGAG 0: 1
1: 0
2: 2
3: 43
4: 358
Right 996715810 5:126587173-126587195 AGGACACATGGGGATGCAGACGG No data
996715805_996715811 7 Left 996715805 5:126587152-126587174 CCAGAGATGGGAGGGAAAATGAG 0: 1
1: 0
2: 2
3: 43
4: 358
Right 996715811 5:126587182-126587204 GGGGATGCAGACGGCAGAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996715805 Original CRISPR CTCATTTTCCCTCCCATCTC TGG (reversed) Intronic
900181856 1:1314619-1314641 CCCCTTTTCCCTCCTACCTCAGG - Intronic
900462819 1:2809584-2809606 CCCATGTCCCCTCCCTTCTCTGG - Intergenic
900722775 1:4188395-4188417 CTCATGTTCCCCCCCACCTTTGG + Intergenic
901409089 1:9070479-9070501 CTCATTTTCCCTGCCCTGCCTGG - Intronic
901866109 1:12107917-12107939 GGCAATTTACCTCCCATCTCCGG - Intronic
901929191 1:12586009-12586031 CTCCTCTTCCCTCCCATCTGGGG + Intronic
903759217 1:25686076-25686098 CTCATTTTCCTTCCCTTCGGAGG + Intronic
904200686 1:28817321-28817343 CGCGTTTTCCCTCCTATCTGAGG + Intronic
904211254 1:28887872-28887894 CTCAGGTTCCCTCTCATCTCTGG + Intronic
905095793 1:35469547-35469569 CACATTTTCGCTCCCATTTTTGG + Intronic
905230863 1:36514310-36514332 CCCAGCTTCCCTCCCACCTCAGG - Intergenic
905301386 1:36988392-36988414 AGCACTTGCCCTCCCATCTCTGG + Intronic
905302175 1:36992928-36992950 CTGACTTACCATCCCATCTCAGG - Intronic
906845111 1:49183366-49183388 CTCATTTCCCCCTCCATCTCAGG + Intronic
907379804 1:54077152-54077174 CCCATTTTCCCTCACCTCTATGG - Intronic
907644826 1:56231887-56231909 ATCATGTTCTCTCTCATCTCTGG - Intergenic
908003181 1:59701750-59701772 CACACATTCTCTCCCATCTCGGG - Intronic
909330100 1:74399629-74399651 ATCCTTTTCCCTTCCATCTGGGG - Intronic
910694477 1:89996797-89996819 TTTATTTTCACTCCCAACTCTGG - Intronic
910800393 1:91139068-91139090 CTGATTTTCCCACCACTCTCTGG - Intergenic
911146284 1:94555427-94555449 CTCCTTTTCCCTCCAGCCTCAGG + Intergenic
912025721 1:105168654-105168676 CTCATTTACCCTCCCACCAACGG - Intergenic
912033362 1:105278182-105278204 ATCTTTTTTTCTCCCATCTCAGG + Intergenic
912093621 1:106113580-106113602 CTCATTTTCTCTAACATTTCTGG - Intergenic
912386199 1:109272413-109272435 CTCCTCCACCCTCCCATCTCCGG - Intronic
912775672 1:112504947-112504969 CTCATCTCCCCTCCCATCCAAGG + Intronic
913115232 1:115690848-115690870 CCCATTTTCCCTCCCCTCTGTGG + Intronic
913161500 1:116150004-116150026 ATCATTTTCCCTCCTCTCTTTGG - Intergenic
913326467 1:117632623-117632645 CTCATATCCCCTGCTATCTCAGG + Intergenic
916987967 1:170212037-170212059 CCCATTCTCCATCCCATTTCAGG - Intergenic
917275200 1:173323759-173323781 TTCATTTTGTCTCCCATCGCTGG - Intergenic
919539602 1:198830551-198830573 CACCTTTCCCCTCCCAGCTCAGG - Intergenic
920412105 1:205770309-205770331 CTTATTTTCCATCCCAGTTCTGG - Exonic
920565887 1:206972768-206972790 CACATTTTCCCTCCTAGCTCAGG + Intergenic
921531206 1:216285173-216285195 CTCATCACCCCTCCCATCACAGG + Intronic
924502722 1:244652650-244652672 TTCATTCACCCTCTCATCTCAGG - Intergenic
1062778581 10:178867-178889 CTCAGTTCCCCTCCTTTCTCAGG - Intronic
1064126118 10:12662205-12662227 CTTATTATCCCTCCCAACTTTGG - Intronic
1064283344 10:13970621-13970643 CTCATTTTTCCTCCTCTCACGGG - Intronic
1064514496 10:16131576-16131598 CTCCTTTTCTCTCCCAGCCCTGG + Intergenic
1064828471 10:19433347-19433369 CCCAAGATCCCTCCCATCTCAGG - Intronic
1065320787 10:24507354-24507376 TTCATTATCCCTGCCATGTCTGG - Intronic
1066490275 10:35887708-35887730 TTCATTTTTCTTCCCATATCAGG - Intergenic
1069929462 10:71872817-71872839 CTCTGTTTCCCTCCCCACTCAGG + Intergenic
1069930597 10:71878920-71878942 CTCATTATCCCTGCTGTCTCTGG + Intergenic
1070278970 10:75035095-75035117 CTCATTTCCCTCCCCATCTCGGG + Intergenic
1070379714 10:75869749-75869771 CCCATCTCCCCTTCCATCTCAGG + Intronic
1070827263 10:79398554-79398576 CCAGGTTTCCCTCCCATCTCTGG - Intronic
1071667989 10:87578734-87578756 CTCCTTTTCCTTCCCTTCCCTGG - Intergenic
1073247599 10:102102546-102102568 CTCATTTTCCCACTGATTTCAGG - Intergenic
1073562228 10:104506688-104506710 CTCGTCCTCCCTCGCATCTCTGG + Intergenic
1073639220 10:105232604-105232626 GTCATCTAACCTCCCATCTCAGG - Intronic
1074048491 10:109861056-109861078 CTCATCTTCCCTCTGAGCTCTGG + Intergenic
1074956940 10:118400331-118400353 CTCTGCTTCCCTCTCATCTCTGG - Intergenic
1075403764 10:122180267-122180289 CTCCTTCCCCCTCCCACCTCAGG + Intronic
1079089411 11:17470222-17470244 CTGTTTCTCTCTCCCATCTCAGG - Exonic
1079132759 11:17757422-17757444 CTCATTTTCCCAGCAATCACAGG - Intronic
1080314703 11:30935918-30935940 GTCTTTTTCCCTCCCTTCTGGGG + Intronic
1081526843 11:43933429-43933451 GTCTTGTTCCCTCCCCTCTCTGG + Intronic
1081751871 11:45517219-45517241 CCCATTTGCCGTCCCTTCTCAGG - Intergenic
1083080245 11:60084930-60084952 CTCTTTTTCTTTCCCTTCTCAGG + Intergenic
1086325982 11:85699890-85699912 CTCATTCACCCTCCACTCTCAGG - Intronic
1087300546 11:96428793-96428815 TTGATTTTCCCCCTCATCTCAGG + Intronic
1087905668 11:103694224-103694246 CTCAAGTTCCCTCTCATTTCAGG + Intergenic
1089064814 11:115654379-115654401 TTCTTTTTCCTTCCCATCTCTGG - Intergenic
1089136316 11:116252162-116252184 CTCATCTTCCCTCTCCTTTCTGG + Intergenic
1089280137 11:117368483-117368505 CTCCTTTGCCCTCGCATCTAAGG + Intronic
1089589803 11:119533078-119533100 CGAATTCTCCCTCCCTTCTCCGG + Intergenic
1089665841 11:120018335-120018357 CTCAGTTTCCCTTTCATATCAGG - Intergenic
1089910934 11:122100419-122100441 CTCATTTTCCCCCCTTGCTCGGG - Intergenic
1090447284 11:126775192-126775214 CTCATGTTGCCTCCCATGGCTGG - Intronic
1090806395 11:130204971-130204993 TTCATTTTCCCTCACCTCTCAGG - Intronic
1091107098 11:132932938-132932960 CTCATTTTGAATCCCAACTCTGG - Intronic
1091443231 12:527660-527682 CTCATGCTCCCTCCCAGCACAGG - Intronic
1094527906 12:31245040-31245062 CTCAGTTCCCCTTCAATCTCAGG - Intergenic
1095039852 12:37428534-37428556 CTCTTTTTCTTCCCCATCTCAGG + Intergenic
1096675526 12:53223612-53223634 CTCTTTTCCCCTCCCCTCCCCGG - Intronic
1097233155 12:57524121-57524143 CTCAGTCTCCCTCCCAGCTGAGG + Intronic
1099257032 12:80327242-80327264 CTCATGTTCCCTCCTGTCTTTGG + Intronic
1102089828 12:110176382-110176404 CTCCTTTTCCCTTCCATTCCTGG - Intronic
1103836262 12:123823469-123823491 ATCACTTTCCACCCCATCTCTGG - Intronic
1103961745 12:124613269-124613291 CTCAGAATCCCTCCCAGCTCAGG + Intergenic
1104735147 12:131131937-131131959 CTCCGTGTCCCTGCCATCTCAGG + Intronic
1104830128 12:131744760-131744782 CTCTTTTTCTCTCCAGTCTCAGG - Intronic
1108808495 13:54189353-54189375 CTCATTTCACCTCCCTTCACAGG + Intergenic
1108984129 13:56561604-56561626 CACATTTTCCATCCCAGATCTGG + Intergenic
1109150789 13:58844931-58844953 CTCTTTTTCTACCCCATCTCAGG - Intergenic
1110113336 13:71779770-71779792 GTCTTTTTCCTTCCCATCCCTGG + Intronic
1110721983 13:78772262-78772284 CTCTTTTGCTGTCCCATCTCTGG - Intergenic
1110803060 13:79723078-79723100 TACAGTCTCCCTCCCATCTCAGG + Intergenic
1113122331 13:106937010-106937032 CGCATTTACTCTCCCATCTGGGG + Intergenic
1114408160 14:22475592-22475614 GTCATTTTTCATCCCACCTCTGG - Intergenic
1117389028 14:55245565-55245587 CCCATTTCCCTTCCCAGCTCTGG + Intergenic
1118936288 14:70291756-70291778 CTCAATTACACTCCCATTTCAGG + Intergenic
1120158968 14:81125569-81125591 CTCAATTTCCCTCCCCTCAGAGG - Intronic
1123400804 15:19983796-19983818 CCCAATTTCCCTCTCCTCTCAGG - Intergenic
1123491941 15:20788096-20788118 CTGATTTCCCCTGCCTTCTCTGG + Intergenic
1124107546 15:26754151-26754173 CTGATTCTGCCTCCCATCTTAGG - Intronic
1124166121 15:27327480-27327502 CTCAGTTTCCCTTACCTCTCTGG - Intronic
1124606639 15:31174376-31174398 CTCACTTTCTCACCCATGTCTGG + Intergenic
1125085895 15:35728808-35728830 CTCTTTTTCTCTGCTATCTCTGG - Intergenic
1125452980 15:39828186-39828208 AGCATTTTCTCTCCCACCTCTGG - Intronic
1125600093 15:40910757-40910779 CTCAGTTTCCCCACCATCTGAGG + Intergenic
1127212595 15:56789472-56789494 CTCATTTACACTCCCATCAACGG - Intronic
1127260727 15:57324382-57324404 CTCATGTCCCTCCCCATCTCAGG + Intergenic
1128136009 15:65263928-65263950 CTCAGATTACCTCCCTTCTCAGG - Intronic
1129121475 15:73399484-73399506 CTCATTTTCCCGGCTAACTCAGG + Intergenic
1131070238 15:89461422-89461444 CTCATCTCCCATCCCTTCTCAGG + Intergenic
1131145880 15:90011631-90011653 CACATTTTCCCTTTCATCTCAGG + Intronic
1131563311 15:93462936-93462958 GTCACTTTCCCTCCCAGCTTTGG + Intergenic
1132303013 15:100788090-100788112 CTCAGTTCCCCGCCAATCTCTGG + Intergenic
1202956779 15_KI270727v1_random:84417-84439 CTGATTTCCCCTGCCTTCTCTGG + Intergenic
1132986886 16:2771906-2771928 CTCTTTTTCCCGCCCCTCCCTGG - Intronic
1133902942 16:9994405-9994427 CTCATTTCACCTCCCACCTGGGG - Intronic
1133958159 16:10465424-10465446 CTCAGTTTCCCTCCCAGATGTGG + Intronic
1134596199 16:15498044-15498066 ATCATTATCCTTCCCATTTCAGG + Intronic
1134690866 16:16190367-16190389 CTCTTTTTCCCTCCGATCCCAGG - Exonic
1135170383 16:20178581-20178603 ATCATTTACAGTCCCATCTCAGG + Intergenic
1135648263 16:24182696-24182718 CTGCTTATCCCTCCCATCTGTGG + Intronic
1136043196 16:27596378-27596400 CTCACTCTCTCTCCCATCTCAGG - Intronic
1136778674 16:32884530-32884552 CTCTGTTTCCCACCCATCACTGG + Intergenic
1136891946 16:33976984-33977006 CTCTGTTTCCCACCCATCACTGG - Intergenic
1139340186 16:66263379-66263401 GTCCTATTCCCCCCCATCTCTGG - Intergenic
1140451556 16:75075059-75075081 CTGCTTTTCCCCCCTATCTCTGG + Intronic
1141568296 16:84918257-84918279 CGCAGTTCCCCTCCCAGCTCAGG + Intronic
1141776265 16:86124537-86124559 AGCATTTCACCTCCCATCTCAGG - Intergenic
1142225264 16:88874047-88874069 CTCTTTTTCCCTCCCCTCCCTGG - Intergenic
1203081090 16_KI270728v1_random:1146624-1146646 CTCTGTTTCCCACCCATCACTGG + Intergenic
1142581282 17:944583-944605 CCCTTTTTTCCTCTCATCTCTGG + Intronic
1142747776 17:1968619-1968641 GCCATGTTCCCTCCCATCCCCGG + Intronic
1143210681 17:5185206-5185228 CTCTTTTTCTCTCCAGTCTCAGG - Intronic
1144410018 17:14991732-14991754 CTCTTTCTCCTTCCCATCTTAGG + Intergenic
1145378020 17:22369948-22369970 CTCTTTTTCTTCCCCATCTCAGG - Intergenic
1146914046 17:36666774-36666796 CTCCCATTCCCTCCCATCTCAGG - Intergenic
1147021947 17:37541791-37541813 CTGATTTTGACTCCCGTCTCAGG + Intronic
1147324868 17:39665329-39665351 CTCATTCTCTCTCCCCTCCCAGG - Exonic
1148462954 17:47848529-47848551 CTCACTTTCCCTCCTAACCCAGG + Intronic
1148770768 17:50064663-50064685 CTCTTCTTTCCTCCCAGCTCTGG - Intronic
1148778510 17:50109150-50109172 CACATGTCCCCTCCCAGCTCTGG + Intronic
1150188319 17:63210388-63210410 CTGATTATCCCTCCCTTCTCTGG + Intronic
1150857268 17:68765165-68765187 CTCATTTTCTCCCCCTTCCCTGG - Intergenic
1151232096 17:72692398-72692420 CTCATTTTCTTTCCAGTCTCAGG - Intronic
1151446210 17:74166002-74166024 CCCCTTTTCCCTCCCACCACAGG - Intergenic
1152147126 17:78575127-78575149 CCCAATTTCCCACCCATCCCTGG + Intronic
1152288904 17:79427685-79427707 CTCATTGTGCTTCCTATCTCAGG - Intronic
1152354175 17:79798631-79798653 CTCTTTCTCCACCCCATCTCTGG - Intronic
1152732520 17:81979345-81979367 CATATATTCCCTCCCAACTCTGG + Intronic
1153220160 18:2854101-2854123 TTCACTTTGCCTCCCAACTCAGG + Intronic
1156405676 18:36780336-36780358 CTCATTTTTGCTTCCATATCAGG - Intronic
1156524450 18:37753455-37753477 CTCTTGTTTCCTCCCTTCTCAGG + Intergenic
1157526668 18:48388215-48388237 CTAATTATCCCTGCCCTCTCTGG + Intronic
1157664072 18:49470366-49470388 CCCATTTTCCCTCGCCACTCAGG - Intergenic
1158519169 18:58156548-58156570 CTGATGTTCCTTCCCAACTCAGG - Intronic
1158544102 18:58381291-58381313 CTTATTTTCTCTCTCATCCCTGG + Intronic
1159056924 18:63475501-63475523 CTCATTTTCCCTCCTACAGCTGG + Intergenic
1160117556 18:76095596-76095618 CTCTTCCTCCCTCCCCTCTCTGG - Intergenic
1161283715 19:3458510-3458532 CTCAGTTTCCCTTCCCTCCCAGG - Intronic
1161828105 19:6583071-6583093 CTCATTTTCCCTCCCTCAGCTGG + Intergenic
1162651301 19:12091048-12091070 CTCATTTTCCTTCCCTTTGCAGG - Intergenic
1163025021 19:14505854-14505876 CTCAATTTCTCTTCCAACTCAGG + Intergenic
1163157696 19:15448470-15448492 CTCAGTTTACCTCCCAGCCCAGG + Intronic
1163469395 19:17487759-17487781 CCCATTTTCACACCCATCTTGGG + Intronic
1163774951 19:19212382-19212404 CTCTTCTTCCCTCCAAACTCGGG - Intronic
1165085635 19:33344740-33344762 CTCTTTTTCCCTTCCCTCTAAGG + Intergenic
1165332605 19:35149307-35149329 GTCAATTTCTCTCCCATCTCAGG + Intronic
1165822164 19:38683494-38683516 CTCATTCTCCCTCCCACCAATGG - Intronic
1166603162 19:44115810-44115832 GTCATTTTTCCTCCTATTTCAGG - Exonic
1166814844 19:45537763-45537785 GTCATTCTCCCTCCCTGCTCTGG - Intronic
1167387373 19:49171798-49171820 CCCCAGTTCCCTCCCATCTCAGG - Intronic
1167483354 19:49746300-49746322 CCCATGTTCCCGCCCACCTCAGG + Intronic
1167612238 19:50513109-50513131 CTCATTTCGCCTCCCAGGTCAGG - Intronic
925371299 2:3347558-3347580 CTCTTTTTCTTTCCCGTCTCGGG + Intronic
926935122 2:18079456-18079478 CCTATTTTCACTCCCATCTCTGG - Intronic
927243424 2:20938067-20938089 TTCATCTTCCCTCCTTTCTCAGG + Intergenic
927310160 2:21621601-21621623 TTCATTTTCACTCTTATCTCTGG + Intergenic
927403077 2:22736395-22736417 CTCCATTTCCCTCTCATTTCAGG + Intergenic
928162471 2:28940550-28940572 GTTAATTTTCCTCCCATCTCTGG - Intronic
928819448 2:35342966-35342988 ATCATTTCCCCTCCGAGCTCGGG + Intergenic
929194885 2:39174659-39174681 CTCATTTCCGCTCCCGTGTCTGG - Intergenic
929268696 2:39948195-39948217 TTCATTTTCCTTCCTTTCTCTGG + Intergenic
929811397 2:45191983-45192005 CCCATTCTCCATCCCATCTCAGG + Intergenic
930136692 2:47909115-47909137 CTTACTTTCCATCCCCTCTCAGG - Intergenic
930340231 2:50103939-50103961 CTCATGTTCTGACCCATCTCAGG + Intronic
931563686 2:63590820-63590842 CTCAATTTCCCTGCCCCCTCAGG + Intronic
933071227 2:77860332-77860354 CTCTTTTTCTTTCCAATCTCAGG + Intergenic
933715214 2:85354892-85354914 CACATTCTCCCTCCCTCCTCAGG - Intronic
933848580 2:86347666-86347688 CTCATTTTCCCTCGAGTATCGGG + Intergenic
934651200 2:96092229-96092251 CTCGTCCTCCCTCCCATCACAGG + Intergenic
934739908 2:96712769-96712791 CTCATTTTCCCATCTATTTCAGG + Intronic
935200862 2:100855388-100855410 CTCTTTTCCCCTCGAATCTCAGG - Intronic
935886414 2:107624452-107624474 CTCAGTTTCTCTTCCTTCTCTGG - Intergenic
935956204 2:108378931-108378953 CTCAGCAGCCCTCCCATCTCAGG + Intronic
936910667 2:117589308-117589330 CTATTGTTCTCTCCCATCTCAGG + Intergenic
939030367 2:137067657-137067679 CCTATTTTCACTCCCAACTCAGG + Intronic
939143608 2:138386172-138386194 AGCATTTTCCATACCATCTCTGG + Intergenic
939471268 2:142624258-142624280 CTCATTTTCCCTGCCAGAGCAGG - Intergenic
939900183 2:147842191-147842213 CTCATTTTCCTTCCCAAACCAGG + Intergenic
940805527 2:158182365-158182387 CCCATTTTCCCTAACATCTTAGG - Intronic
941697828 2:168572274-168572296 CTTCTTTCCCCTCCCTTCTCAGG - Intronic
942438506 2:176006234-176006256 CCCAATTTCTCTCCCAGCTCTGG - Intergenic
942979999 2:182069361-182069383 CTCATCTTTCCTCACATCTTTGG + Intronic
943505027 2:188744186-188744208 CTCATTGTTCCTCCCTTCTAAGG - Intronic
943789888 2:191920561-191920583 CTCATTTGCCTTCCCCTCTTTGG + Intergenic
945019621 2:205557812-205557834 CTCATTTTCCCTGGCTTCTTGGG + Intronic
946225010 2:218259811-218259833 CGCCTGTTCCCTCCCATTTCAGG + Intronic
947552815 2:231058755-231058777 GTCAGTTTCTCTCCTATCTCGGG + Intronic
947719696 2:232363019-232363041 CTCATTTACCTAGCCATCTCTGG + Intergenic
1168860156 20:1040373-1040395 CTGATTTTTCCTTTCATCTCAGG + Intergenic
1170608808 20:17895126-17895148 CTCCGTTTCCCTCCCTGCTCTGG + Intergenic
1170786074 20:19468815-19468837 CTCCTTGCCCCTCTCATCTCAGG - Intronic
1174531728 20:51219780-51219802 CTCATTTTCTCTCAAATCACAGG + Intergenic
1174558736 20:51414890-51414912 CTCATTTTCACTCCAGCCTCTGG + Intronic
1175432135 20:58912849-58912871 ATCATTTTCCTTGGCATCTCTGG - Intergenic
1175686075 20:61029766-61029788 CTCCTTCTCTCCCCCATCTCTGG + Intergenic
1177059582 21:16354011-16354033 CTCTTTTTCTTCCCCATCTCAGG + Intergenic
1178201053 21:30405733-30405755 CTCATTTTCCCTCCCTTCATCGG + Intronic
1178221987 21:30670225-30670247 CTCTTTTTCTTTCCAATCTCAGG + Intergenic
1179308176 21:40173748-40173770 CTCATCTTTCCTCCCATTCCGGG - Intronic
1179369702 21:40793253-40793275 CTCAGAATCCCTCCCATCACAGG - Intronic
1181077013 22:20386216-20386238 AACATTTTCCCTGCCATTTCTGG - Intronic
1181284229 22:21740468-21740490 CTCTCTTTCCCTCACATCCCAGG + Intergenic
1181812689 22:25413572-25413594 CACATTTTCCCTCCAATGTGAGG + Intergenic
1181969836 22:26681665-26681687 GGCATTTTCCCAGCCATCTCAGG + Intergenic
1182053663 22:27332430-27332452 CTCTCTTTCCCCCCCATCCCCGG + Intergenic
1182594366 22:31407286-31407308 CTCATTTTCGCATCCATCTGTGG + Intronic
1183072626 22:35406968-35406990 CTGCTTTTCCCTCCCAACCCTGG - Intronic
1183334668 22:37239835-37239857 CTAATTCTCCCTCCCTGCTCAGG + Intronic
1184837014 22:47029773-47029795 CTCCTGTTCCCTTCCAGCTCAGG + Intronic
1185102120 22:48846164-48846186 CTCACTTTCCTTCCCAGCACTGG - Intronic
949416963 3:3825381-3825403 CTCATTTTCCTTCCTCTTTCAGG - Intronic
951306242 3:21066528-21066550 CACATTTTCCCTTTCAGCTCTGG - Intergenic
951339340 3:21465867-21465889 CTCATTCTCCATCACACCTCAGG + Intronic
951855142 3:27187548-27187570 CTCATTTTCTCTTCCATCCCTGG - Intronic
952337367 3:32415494-32415516 CTCAGTTTCCCTCCCTTATCAGG - Intronic
952425207 3:33168567-33168589 CTCGTTCTCCTCCCCATCTCAGG + Intronic
953150942 3:40323937-40323959 ATCATTTTGCCTCTCATCTGAGG + Intergenic
955108779 3:55927024-55927046 CTGATTTGCCCTCCACTCTCAGG - Intronic
959104768 3:102052742-102052764 CTCATTTTCTTCCCAATCTCAGG + Intergenic
960830097 3:121836773-121836795 CTCCTTTTCTCTTCCTTCTCAGG + Intronic
960903172 3:122572367-122572389 CTCTTTTTCATTGCCATCTCTGG + Exonic
961117066 3:124339462-124339484 CTCATTTTGCGTCCCCTCTTTGG - Intronic
961520406 3:127464415-127464437 CTCATTCTCCCTCGAATCTCAGG - Intergenic
961569382 3:127787012-127787034 CTCATTTTACCTCCAAACCCCGG - Intronic
961948446 3:130719593-130719615 CTCATTTTCCCTCTTATCACAGG - Intronic
962245574 3:133788647-133788669 CTCTTTTTCCTTTCCAACTCGGG + Intronic
962900744 3:139759299-139759321 GTCATTTTCCCTCCCTGCTTTGG - Intergenic
963789341 3:149567620-149567642 CTCATTTTTCCTCCCCTTTCTGG - Intronic
964194231 3:154044178-154044200 CCCATTTTCCATGCCATCTGAGG + Intergenic
964250667 3:154712582-154712604 CTGATCTTCCTTCCCAGCTCAGG + Intergenic
964389744 3:156184847-156184869 GCCATTTTCCCTCCCATCCCTGG + Intronic
965928430 3:174012091-174012113 CTCCTTTTCTCTCCCTCCTCAGG + Intronic
966025662 3:175277781-175277803 ACCATTTACCCTCCTATCTCAGG + Intronic
966068489 3:175845388-175845410 CTCAATTTCCCTCCATACTCAGG - Intergenic
966148790 3:176843074-176843096 ATCATTTTCTTTCCCATCTGTGG - Intergenic
969594933 4:8143479-8143501 CATACTCTCCCTCCCATCTCGGG + Intronic
969825561 4:9755498-9755520 TTTGTTTTCCTTCCCATCTCGGG + Intergenic
969896860 4:10313475-10313497 CTCATTCTCCCTCCCTCCTGTGG + Intergenic
970050796 4:11912803-11912825 CTCATGATCTTTCCCATCTCAGG - Intergenic
970290976 4:14572025-14572047 CTGATTTTTCCTCCACTCTCTGG - Intergenic
970832627 4:20360048-20360070 CTCATTTTCTCTTCCAGATCAGG + Intronic
970903180 4:21183909-21183931 CTCCTTTCCTCTCCCTTCTCAGG + Intronic
971131689 4:23818067-23818089 CTCATCTTCCCACTAATCTCTGG + Intronic
972810318 4:42578061-42578083 CCCATTTTCCCTACAATGTCTGG + Intronic
973263591 4:48187937-48187959 CACATTTTTCCTCCCCTTTCTGG + Intronic
973563294 4:52158376-52158398 CTCCATTTTCCTCTCATCTCAGG + Intergenic
973605429 4:52582580-52582602 CTCATTATCATTCCCATCTAGGG - Intergenic
975024997 4:69536600-69536622 CTGATTCTTTCTCCCATCTCTGG - Intergenic
975929351 4:79499900-79499922 CTCACTATCACTCCCATGTCTGG + Intergenic
976064415 4:81167665-81167687 CCCATGTTCCCTCCCAACCCCGG - Intronic
976723655 4:88194809-88194831 ACCATTTTCCCTCCCATTACTGG - Intronic
978389189 4:108206573-108206595 ATCATTTTGCCTCCCATACCAGG + Intergenic
978493027 4:109329145-109329167 TTCATTGTCCCTCACATCCCTGG - Intergenic
978628334 4:110713292-110713314 CTCATTTTTCCTCCTTTCTGAGG + Intergenic
978712392 4:111800113-111800135 CTCATTTTCTCTTCCATTTCTGG - Intergenic
980664900 4:135919560-135919582 CTCATCTTCACACCCATTTCTGG + Intergenic
981022234 4:140041291-140041313 CTTCTTTTCCTTCCTATCTCTGG - Intronic
981596507 4:146429618-146429640 CTGATCTTCTCTCCCATCTCTGG - Intronic
982718387 4:158833499-158833521 CTCCTTTTCCCCCCCATCTCCGG + Intronic
982941904 4:161569715-161569737 CTCATTTTCCTTTTCATATCTGG - Intronic
985504153 5:269174-269196 TTTATTCTCCCTCCCATCACTGG - Intergenic
986002327 5:3640031-3640053 CTCATTTCCCCTCCCTGCCCTGG + Intergenic
986718002 5:10537915-10537937 ATGAGTTTCCCTCCCACCTCTGG - Intergenic
987188551 5:15450297-15450319 CTCTTTGTCCCTCCCATCTCTGG - Intergenic
987251508 5:16105840-16105862 TTGAGTTCCCCTCCCATCTCTGG + Intronic
987557676 5:19476049-19476071 CTCACTTTCCTTTCCATCTCTGG - Intronic
987815740 5:22899619-22899641 CTCCTTTTCTCTCTCATCTGAGG - Intergenic
989261645 5:39425151-39425173 CACATTTCCCCTCCCGTCGCTGG - Exonic
990384024 5:55241972-55241994 CTCAGATTCCCTCCTATCTGTGG + Intergenic
991465369 5:66906863-66906885 CTCATCTTCCATCTCATCTCTGG - Intronic
992002042 5:72445286-72445308 CTCAGTGTCCCGCCCATCCCTGG - Intronic
992760195 5:79944583-79944605 CTCTTTTTCTCTCCTATCCCTGG + Intergenic
993477360 5:88381584-88381606 CTCTTGTTCCCTACCATCACTGG + Intergenic
996312183 5:122119185-122119207 CCCATCTTCCCTTCCATCTGGGG - Intergenic
996715805 5:126587152-126587174 CTCATTTTCCCTCCCATCTCTGG - Intronic
996749700 5:126876102-126876124 CTCGTTTCATCTCCCATCTCAGG - Intronic
997053777 5:130415157-130415179 ATCATTTTCCTCCCAATCTCTGG - Intergenic
997401895 5:133610452-133610474 CGCTTTTTCCCTCCCATCCTAGG - Intronic
997638706 5:135434620-135434642 CTCCCTGTCCCTCCCATGTCTGG + Intergenic
998133371 5:139662096-139662118 CTCATTCTTCCCCCCATCTCTGG - Intronic
999278301 5:150347028-150347050 CTCCTTTTCCCTCCCACCCATGG - Intergenic
1000358144 5:160420793-160420815 CTCTTTTTCCCTGGCATTTCAGG - Intronic
1000393215 5:160746849-160746871 GGCAATTTACCTCCCATCTCTGG - Intronic
1000463371 5:161548022-161548044 CTCATTTTGCCTGCCTTCTAGGG - Intronic
1001448877 5:171808802-171808824 TTCTTCTTCCCTCCCCTCTCTGG - Intergenic
1001942706 5:175751819-175751841 CCCATGGTCGCTCCCATCTCAGG - Intergenic
1003019422 6:2496904-2496926 CTGACTTTCCCCCACATCTCTGG - Intergenic
1005325527 6:24696349-24696371 CTCAGTTTCCATCACATCTTGGG + Intronic
1005685821 6:28252244-28252266 CTCAACTTCCCTCCTATGTCTGG - Intergenic
1006702359 6:35985787-35985809 CTCCTTTCCCAGCCCATCTCTGG - Intronic
1007115345 6:39339403-39339425 CGCCTTTTCCCTCCCAGCTCGGG + Intronic
1007341756 6:41195068-41195090 TTCTTTTTCCCTCCCGTGTCAGG + Intronic
1007599342 6:43072107-43072129 CTCATTCTCTCTTCCTTCTCTGG + Intronic
1008417533 6:51260240-51260262 CACATCTTCCCTGCCATCGCCGG + Intergenic
1008799450 6:55348592-55348614 CACATTTTCCCTGCGTTCTCAGG + Intronic
1009553930 6:65137490-65137512 CTGATTCTCCATTCCATCTCTGG - Intronic
1009935812 6:70233129-70233151 CTCATTTTTCTTCCCATCCTGGG - Intronic
1010802572 6:80194160-80194182 CTTATTTTCCCAGCCATCTAAGG + Intronic
1012058513 6:94446645-94446667 CTTATTTTCCACCCCAACTCAGG + Intergenic
1012779294 6:103536268-103536290 CTCATCTTCCCTCTCCCCTCTGG + Intergenic
1013981494 6:116134888-116134910 CTCCTTTTTCTTTCCATCTCAGG - Intronic
1015540515 6:134309018-134309040 CTCTTTTTCCCTCCTAGGTCAGG - Intronic
1015825777 6:137309905-137309927 CTCATTTTCTTTCCCCTCTCAGG + Intergenic
1017247821 6:152246037-152246059 ATATTTTTCCCTCTCATCTCTGG - Intronic
1017449486 6:154540997-154541019 ATTATTTTCCCTCCCATCCCTGG - Intergenic
1017547665 6:155469197-155469219 CTCTTTTTCTTCCCCATCTCAGG - Intergenic
1017559922 6:155615786-155615808 CTCATCTTCCCTCCCTGCTAGGG - Intergenic
1019311386 7:362999-363021 AGCATTCTCCATCCCATCTCAGG - Intergenic
1021971282 7:25968059-25968081 GTCGTGTTCCCTCCCATCTCTGG - Intergenic
1022387197 7:29912897-29912919 TTCTTTTTCCCTCTAATCTCTGG - Intronic
1023414413 7:39918695-39918717 CTCACTTTCCCCCCTCTCTCTGG + Intergenic
1024119289 7:46220858-46220880 CCCCTCTTCCCTCCCACCTCAGG - Intergenic
1024386710 7:48760317-48760339 CTCATTCACTTTCCCATCTCTGG + Intergenic
1024405587 7:48975895-48975917 CTCCATTTCCCTCCCTTTTCAGG - Intergenic
1024627917 7:51224350-51224372 CTCTTTTTCATTCCTATCTCAGG - Intronic
1025969817 7:66311897-66311919 CTCATCTTCTCTCCCAGCTTTGG + Intronic
1026258166 7:68730921-68730943 GGCTTTTTCCCTCCCATCCCTGG - Intergenic
1028422926 7:90653456-90653478 CCCATTTTTCCTCCTTTCTCTGG + Intronic
1029823343 7:103165587-103165609 CTCCTTTTCCCCCCAATTTCAGG - Intergenic
1029976153 7:104836164-104836186 CTGATTCTCCTTCCCATCTTAGG - Intronic
1030958011 7:115879201-115879223 CTCATTTTCTCTTGCATCTTGGG + Intergenic
1034828811 7:154291128-154291150 CTCAGTGACCCTCTCATCTCAGG - Intronic
1034876877 7:154732634-154732656 CTCACTTTCCCTGCCATCCCAGG - Intronic
1035253248 7:157611004-157611026 CTCATTTTCATGACCATCTCTGG - Intronic
1037560753 8:20072627-20072649 CTCCTTTTCTTTCCCATCTCGGG - Intergenic
1040617269 8:49049363-49049385 CCCTTTTTCCCTCCCACTTCTGG + Intergenic
1040639560 8:49317383-49317405 TTCATTTGCCCTTTCATCTCAGG - Intergenic
1041145531 8:54872319-54872341 GTCATTTTCCCTGCCCTCTGAGG + Intergenic
1041598379 8:59684723-59684745 ATCATTTTCAGTCCCTTCTCTGG - Intergenic
1042093744 8:65189155-65189177 CTCATTTCCCCTCCCTTCCTGGG - Intergenic
1042449061 8:68923233-68923255 CTCAGTTTCCCCCGCATCTGAGG - Intergenic
1042704161 8:71649267-71649289 CTCATTCTCTGTCACATCTCAGG - Intergenic
1043273879 8:78369045-78369067 CTACTTTTTCCTCCTATCTCTGG + Intergenic
1043335370 8:79169871-79169893 CTTTTTTCTCCTCCCATCTCAGG + Intergenic
1043855517 8:85260866-85260888 CTCATTTTCCTTACCAACTCAGG + Intronic
1044744200 8:95356421-95356443 CTCATTTGCCCTCAAATTTCAGG - Intergenic
1045015151 8:97994922-97994944 CTCCTTCTACCTCTCATCTCTGG - Intronic
1045064657 8:98434790-98434812 CTCTCTTTCCCTCCGATTTCTGG - Intronic
1045749214 8:105461663-105461685 CTCTTTTTCATTCCCATCTCTGG + Intronic
1046138443 8:110061021-110061043 ATCCTTTCCCCTCCCAGCTCAGG + Intergenic
1047230828 8:122996458-122996480 CTCCTTTGCTCTCCCATCACAGG + Intergenic
1047783810 8:128134223-128134245 CTGATTTTCCATCCCAGCACAGG + Intergenic
1048275686 8:133064111-133064133 CTTATTTTCCCTCCGGTCTTTGG + Intronic
1050038871 9:1466335-1466357 CTCCCTTGCCCTCCCATCACTGG - Intergenic
1051502665 9:17795196-17795218 GTCATTGTCCCTCCTATTTCTGG + Intronic
1052690232 9:31808137-31808159 ATCTTTTCCCCTCCCAGCTCGGG - Intergenic
1053826571 9:42030724-42030746 CTCTTTCTCACTCCCTTCTCCGG - Intronic
1054603989 9:67156673-67156695 CTCTTTCTCACTCCCTTCTCCGG + Intergenic
1055048936 9:71960214-71960236 TTCATTTTCCCTCCATTCCCTGG - Intronic
1055723394 9:79200686-79200708 CTCATTTTTCTTTCCATCTCTGG - Intergenic
1056179298 9:84066152-84066174 CTCATGTTCTCTCCCATCCCTGG - Intergenic
1056792360 9:89634026-89634048 TCCATGTACCCTCCCATCTCTGG - Intergenic
1056826265 9:89878346-89878368 CTCCTTCTCCCTGCCTTCTCTGG - Intergenic
1057201111 9:93140452-93140474 GACATTTTCCCACCCATCCCAGG + Intergenic
1057304107 9:93902584-93902606 CTCACCTTCCCTCCCACCTTGGG - Intergenic
1057833692 9:98427260-98427282 CTCCTTTCCCCTCCCACCTCTGG + Intronic
1057853051 9:98580159-98580181 AGCATTTTCCTTCCCACCTCTGG + Intronic
1057890553 9:98866932-98866954 CTCATCATCCCTCCCATTTGCGG + Intergenic
1058672286 9:107369902-107369924 CTCATTTGGACTTCCATCTCTGG + Intergenic
1059930470 9:119255411-119255433 ATCATCTGCCCTCCCACCTCTGG - Intronic
1061405945 9:130393181-130393203 CTCCTTCTCCCTCTCCTCTCGGG + Intronic
1061432091 9:130537411-130537433 CACATGTACCCTGCCATCTCTGG + Intergenic
1061637687 9:131924406-131924428 CTCATTTTCTATCCCATTTTTGG + Intronic
1185497724 X:568204-568226 CTGACTTTCCCTCCAATCTGTGG + Intergenic
1187403564 X:18983782-18983804 CTCATTCTCCTTCCCAGGTCTGG - Intronic
1187639347 X:21271536-21271558 ATCTTTTTCTCTCCCACCTCTGG - Intergenic
1188276280 X:28205571-28205593 CTCATTTTCCCTCTCATTCCTGG + Intergenic
1188651451 X:32635454-32635476 CTCATTTTCCCTCAAATATATGG + Intronic
1189236620 X:39491937-39491959 CTCATTATCTCACCCAGCTCAGG + Intergenic
1190939257 X:55025076-55025098 CTCATTTCCCCTCCCTCTTCTGG - Intronic
1191665585 X:63699096-63699118 CTCTTTCACCCTACCATCTCTGG + Intronic
1191666159 X:63704902-63704924 CTCATTTTCTCACCCCTTTCAGG - Intronic
1191669614 X:63737077-63737099 CTGACTTTCCCTCCCTGCTCAGG + Intronic
1192280107 X:69675998-69676020 CTCATGTTCTCCCCCATCTGAGG - Intronic
1192631698 X:72782363-72782385 CTAATGCTCCCTCCCATCCCTGG + Intronic
1192635001 X:72807921-72807943 CTAATGATCCCTCCCATCCCTGG + Intronic
1192646714 X:72912882-72912904 CTAATGCTCCCTCCCATCCCTGG - Intronic
1192650011 X:72938438-72938460 CTAATGCTCCCTCCCATCCCTGG - Intronic
1193786078 X:85760891-85760913 GGCATTTTCCCTCACACCTCTGG + Intergenic
1195614686 X:106903062-106903084 CTCATTTTCCTTCCTCTCTCAGG + Intronic
1195778756 X:108437993-108438015 CTCACCCTCCCTCCCATTTCAGG - Exonic
1199699755 X:150366242-150366264 CTCCCCTCCCCTCCCATCTCTGG + Intronic
1200101150 X:153689519-153689541 CTCTGTTTCCCACCCATCACCGG - Intronic
1200160180 X:154003231-154003253 CCCATTTTCCCTTCCAGCTGAGG - Intergenic
1200224282 X:154408720-154408742 CTCACTTTCCCTCTCGTCTCTGG + Intronic