ID: 996726140

View in Genome Browser
Species Human (GRCh38)
Location 5:126674756-126674778
Sequence TTTAAGTTCTTGAGAGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996726139_996726140 13 Left 996726139 5:126674720-126674742 CCAAGCAGTATTGTAGAAGAAAA No data
Right 996726140 5:126674756-126674778 TTTAAGTTCTTGAGAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996726140 Original CRISPR TTTAAGTTCTTGAGAGAAGA AGG Intergenic
No off target data available for this crispr