ID: 996729710

View in Genome Browser
Species Human (GRCh38)
Location 5:126705282-126705304
Sequence TTGGTGAACTGAACTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996729710_996729714 4 Left 996729710 5:126705282-126705304 CCTTCCTCAGTTCAGTTCACCAA No data
Right 996729714 5:126705309-126705331 TGGTGACCCTTTACCTGATTCGG No data
996729710_996729715 7 Left 996729710 5:126705282-126705304 CCTTCCTCAGTTCAGTTCACCAA No data
Right 996729715 5:126705312-126705334 TGACCCTTTACCTGATTCGGTGG No data
996729710_996729719 17 Left 996729710 5:126705282-126705304 CCTTCCTCAGTTCAGTTCACCAA No data
Right 996729719 5:126705322-126705344 CCTGATTCGGTGGTATCTTCAGG No data
996729710_996729720 18 Left 996729710 5:126705282-126705304 CCTTCCTCAGTTCAGTTCACCAA No data
Right 996729720 5:126705323-126705345 CTGATTCGGTGGTATCTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996729710 Original CRISPR TTGGTGAACTGAACTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr