ID: 996729968

View in Genome Browser
Species Human (GRCh38)
Location 5:126707460-126707482
Sequence CTGCAGTAATTGGGGAAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996729963_996729968 2 Left 996729963 5:126707435-126707457 CCTTTTACTTCACTTTTGGCCTT No data
Right 996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG No data
996729961_996729968 30 Left 996729961 5:126707407-126707429 CCGATTTTAAAATGTGTGGAACT No data
Right 996729968 5:126707460-126707482 CTGCAGTAATTGGGGAAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996729968 Original CRISPR CTGCAGTAATTGGGGAAAAA AGG Intergenic
No off target data available for this crispr