ID: 996735365

View in Genome Browser
Species Human (GRCh38)
Location 5:126753605-126753627
Sequence TAATCATGTATTACAGCTAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996735364_996735365 -1 Left 996735364 5:126753583-126753605 CCACACATAGACTTTAATGTTAT No data
Right 996735365 5:126753605-126753627 TAATCATGTATTACAGCTAAAGG No data
996735363_996735365 3 Left 996735363 5:126753579-126753601 CCAACCACACATAGACTTTAATG No data
Right 996735365 5:126753605-126753627 TAATCATGTATTACAGCTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996735365 Original CRISPR TAATCATGTATTACAGCTAA AGG Intergenic
No off target data available for this crispr