ID: 996736282

View in Genome Browser
Species Human (GRCh38)
Location 5:126761625-126761647
Sequence AAAGAATTGTTGGCCGGGTG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996736278_996736282 -6 Left 996736278 5:126761608-126761630 CCACATGTAATTATTATAAAGAA No data
Right 996736282 5:126761625-126761647 AAAGAATTGTTGGCCGGGTGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996736282 Original CRISPR AAAGAATTGTTGGCCGGGTG CGG Intergenic
No off target data available for this crispr