ID: 996736282 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 5:126761625-126761647 |
| Sequence | AAAGAATTGTTGGCCGGGTG CGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 996736278_996736282 | -6 | Left | 996736278 | 5:126761608-126761630 | CCACATGTAATTATTATAAAGAA | No data | ||
| Right | 996736282 | 5:126761625-126761647 | AAAGAATTGTTGGCCGGGTGCGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 996736282 | Original CRISPR | AAAGAATTGTTGGCCGGGTG CGG | Intergenic | ||
| No off target data available for this crispr | |||||