ID: 996738121

View in Genome Browser
Species Human (GRCh38)
Location 5:126776067-126776089
Sequence ATCCATGAAAAGCCTGGTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996738115_996738121 9 Left 996738115 5:126776035-126776057 CCCACATCACACGGAGATTGTGT No data
Right 996738121 5:126776067-126776089 ATCCATGAAAAGCCTGGTGCTGG No data
996738116_996738121 8 Left 996738116 5:126776036-126776058 CCACATCACACGGAGATTGTGTG No data
Right 996738121 5:126776067-126776089 ATCCATGAAAAGCCTGGTGCTGG No data
996738114_996738121 16 Left 996738114 5:126776028-126776050 CCAGTTTCCCACATCACACGGAG No data
Right 996738121 5:126776067-126776089 ATCCATGAAAAGCCTGGTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996738121 Original CRISPR ATCCATGAAAAGCCTGGTGC TGG Intergenic
No off target data available for this crispr