ID: 996738186

View in Genome Browser
Species Human (GRCh38)
Location 5:126776642-126776664
Sequence GTCCCCGGCCACCGCGGGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 165
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 146}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996738186_996738192 6 Left 996738186 5:126776642-126776664 CCACGCCCGCGGTGGCCGGGGAC 0: 1
1: 0
2: 0
3: 18
4: 146
Right 996738192 5:126776671-126776693 AGTTTCGCGTGTGGCTTTTAGGG 0: 1
1: 0
2: 0
3: 1
4: 59
996738186_996738190 -3 Left 996738186 5:126776642-126776664 CCACGCCCGCGGTGGCCGGGGAC 0: 1
1: 0
2: 0
3: 18
4: 146
Right 996738190 5:126776662-126776684 GACACTCTGAGTTTCGCGTGTGG 0: 1
1: 0
2: 0
3: 3
4: 37
996738186_996738191 5 Left 996738186 5:126776642-126776664 CCACGCCCGCGGTGGCCGGGGAC 0: 1
1: 0
2: 0
3: 18
4: 146
Right 996738191 5:126776670-126776692 GAGTTTCGCGTGTGGCTTTTAGG 0: 1
1: 0
2: 0
3: 4
4: 47

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996738186 Original CRISPR GTCCCCGGCCACCGCGGGCG TGG (reversed) Intronic
900092018 1:924713-924735 CTTCTCGGCCACCGCGGCCGCGG + Intergenic
900119645 1:1043015-1043037 GTCCCCGGTGGCTGCGGGCGAGG - Intronic
901762236 1:11478864-11478886 GGCCCTGGCGCCCGCGGGCGGGG - Intergenic
902585753 1:17438000-17438022 GACCCCGGGCACCGCGCGGGCGG - Intronic
903034469 1:20485424-20485446 GACCCTGTCCGCCGCGGGCGGGG - Exonic
903792793 1:25906179-25906201 GTCCCCGCTCTCCGGGGGCGCGG - Intronic
904601953 1:31678157-31678179 CTCCCCTGCCACCGTGGGCTGGG - Intronic
904940923 1:34164612-34164634 GTGCCCCGCAACCCCGGGCGGGG + Intronic
908380565 1:63593652-63593674 GTCCCCGCCCACCACCAGCGTGG - Intronic
912474230 1:109925408-109925430 GTCCCTGGCCTCAGCGGGGGTGG - Intronic
914942633 1:152036566-152036588 CTCCCGGGAGACCGCGGGCGAGG + Intronic
1069676999 10:70255487-70255509 GGGCCCGGCCCCCGGGGGCGAGG - Exonic
1072089633 10:92115039-92115061 CGCCCCGGCGGCCGCGGGCGCGG + Intronic
1077028059 11:450500-450522 GTCCCCGGTGCCCGCGGGCAGGG + Exonic
1077247501 11:1546752-1546774 GGCCCCAGCCTCGGCGGGCGCGG + Intergenic
1077247584 11:1547027-1547049 GTCCCCAGGCACTGCTGGCGTGG - Intergenic
1078210262 11:9264908-9264930 GTCCCCGACGACAGCGGGCGCGG + Intronic
1080515439 11:33015744-33015766 GTCCCCGACCACCGCTCGCGTGG + Intergenic
1089442800 11:118530925-118530947 GACCCGGGCGTCCGCGGGCGAGG + Exonic
1089443334 11:118533320-118533342 GTCCCCAGCCACCCTGGGCAAGG + Intronic
1089452610 11:118608299-118608321 CTCCCCGGCCCCCGAGGACGTGG - Intronic
1089700250 11:120240228-120240250 GTTCCCGGCCGCCGCCGCCGCGG - Intronic
1092791232 12:12072418-12072440 GACCCCGGCCACCTCGGGGAGGG + Intronic
1097889225 12:64760277-64760299 CTCACCGCCCACCGTGGGCGCGG + Intergenic
1103325350 12:120116639-120116661 GTCCCGGGCCATGGCGGGCGGGG + Exonic
1103722048 12:122980443-122980465 TTCCCAGGGCACCGGGGGCGTGG + Exonic
1112051128 13:95644469-95644491 CTCCTCGGCCTCCGCGGGCCCGG - Intronic
1112290909 13:98143403-98143425 GCCCCCGGCGGCCGAGGGCGCGG - Intronic
1113432335 13:110261792-110261814 GTCCTCTGCCACCCCGGGCCTGG + Intronic
1113517691 13:110915483-110915505 GCCCCCGGCCGCCCCAGGCGTGG - Intergenic
1113949089 13:114061199-114061221 GTCCCCGGCCGTGGCGGGGGTGG - Intronic
1114483207 14:23047946-23047968 GGCCCGGCCCACCGCGGGGGGGG - Exonic
1115399252 14:32939162-32939184 GGCCCCGGCCACCGCCCGCCGGG + Intronic
1117253234 14:53955102-53955124 GTCCCGCGCCACCGCTGGGGCGG + Intronic
1119480633 14:74955658-74955680 GGCCCCGCCCACCGCAGACGAGG + Exonic
1122220801 14:100238433-100238455 GGCCCCGGGCACCACGGGGGCGG - Intronic
1124648117 15:31454177-31454199 GACCCCGGCCTCCCCGGGCCCGG + Intergenic
1127256974 15:57300771-57300793 GACCCCGGCCACAGCGGGAGGGG - Intergenic
1131215185 15:90530209-90530231 GGCCCGGGCCGGCGCGGGCGGGG + Intronic
1132504153 16:298353-298375 GCCCCCGGCCACCCTGGGCTGGG - Intronic
1132519487 16:380928-380950 GTCCCAGGCCACAGAGGCCGGGG + Intronic
1132669496 16:1096801-1096823 CTCCCAGGCCTCAGCGGGCGGGG + Intergenic
1134066795 16:11233449-11233471 GTCACCGGCAACCCCGGGAGCGG + Intergenic
1138583420 16:57956071-57956093 GGCCCTGGCCACAGCTGGCGGGG + Intronic
1140661042 16:77191509-77191531 TGCCCCGGCCCCCGGGGGCGCGG + Exonic
1141172168 16:81698283-81698305 GTCCCCGGTCACCGGGGCTGGGG - Intronic
1141184824 16:81779569-81779591 GACCCCGGGCACGGCGGGCCGGG - Intronic
1141620854 16:85235887-85235909 GCGCCCGGCCAGCGCGGGGGCGG - Intergenic
1142156485 16:88534760-88534782 GTCCCCGGCCGCCGCGCCCGAGG + Exonic
1142378792 16:89720687-89720709 GTCCTCGCCCTCCCCGGGCGGGG + Intronic
1142378843 16:89720841-89720863 GTCCCCGGCCGCAGCGGCCATGG + Exonic
1142618117 17:1148469-1148491 GTCCCCAGCCCCCCCGGGCATGG + Intronic
1142869290 17:2809812-2809834 CTCTCCAGCCACCGCGGGAGAGG + Intronic
1145236840 17:21214314-21214336 GGCCCCGGCGACCCCGGGGGCGG - Exonic
1148337538 17:46851646-46851668 GGCCAGGGCCAGCGCGGGCGGGG - Exonic
1148790342 17:50169161-50169183 GGCCCTGGGCACAGCGGGCGTGG - Exonic
1150310996 17:64129687-64129709 CTCCCCGGACCCCGCGGGCTCGG - Intronic
1152680797 17:81666822-81666844 GTCCCCGGCGAGCGCGGGGGCGG + Exonic
1153480716 18:5543740-5543762 GACCCCGGCCGCGCCGGGCGCGG + Intronic
1154241718 18:12658482-12658504 GTCCCCGGCCGACTCTGGCGGGG + Intronic
1157384315 18:47248365-47248387 GCCTCCGGCCACCGCGGCCGCGG + Intronic
1158602114 18:58864070-58864092 GTGCCCGGCCGGCGCCGGCGGGG - Intronic
1160080793 18:75725403-75725425 GTCCCCCGCCAGAGCGGGCCTGG + Intergenic
1161033405 19:2070602-2070624 GTCCAAGGCCACAGCGGGCTAGG + Intergenic
1161042070 19:2115589-2115611 GTACCAGGACACCCCGGGCGTGG - Exonic
1161516578 19:4699894-4699916 CTCCCAGGCCACCTCGGGAGTGG - Intronic
1162573089 19:11483614-11483636 GGCCCCGGCAAGCCCGGGCGTGG + Exonic
1162809694 19:13156203-13156225 GTGCCCGGCCACCGTGGGGCTGG + Intergenic
1166882922 19:45940163-45940185 GCCCCCGGCCGCCCCGGCCGCGG + Exonic
1167441833 19:49513313-49513335 CTCCCGGGACACCGCGGGCACGG - Intronic
1168646110 19:58060074-58060096 GTGCCCGGCCTCCTCGCGCGCGG + Intronic
932398962 2:71466593-71466615 CTCCCCGCCCGCCGCGGGCAGGG + Intronic
932567357 2:72918152-72918174 TGCCGCGGCCGCCGCGGGCGCGG + Exonic
934079007 2:88452152-88452174 CTCCCCGGGCCCCGCGGGCGCGG + Exonic
934618368 2:95789466-95789488 CTCCCCTCCCACCGCGGGCCAGG + Intergenic
934642525 2:96035093-96035115 CTCCCCTCCCACCGCGGGCCAGG - Exonic
935354543 2:102186972-102186994 TTTCCCCGCCACCGTGGGCGGGG - Exonic
937084097 2:119159064-119159086 GTGCCCCGCCACTGCGTGCGTGG - Intergenic
946412634 2:219522733-219522755 CTCCCCGGCCGCCGCGGGGGCGG + Intronic
948438130 2:237967399-237967421 GTCCCCCGCCGCCGCCGCCGCGG - Intronic
948560450 2:238848134-238848156 GTGCTCGGCGACCGCGGGCTTGG + Exonic
949069199 2:242013279-242013301 CTCCCCGGCCACCTCGGGCTGGG - Intergenic
1171011939 20:21513730-21513752 CTCCCCTGCCCCGGCGGGCGGGG + Exonic
1172083312 20:32358919-32358941 GGCCCTGCCCACCGCGGGAGGGG + Intronic
1173454084 20:43189758-43189780 GGCCCCGGCCCCCGCGGGAAGGG - Exonic
1178416979 21:32412392-32412414 GCACCCGGCCAGCGCGGGCAGGG + Exonic
1179911989 21:44455493-44455515 GACTCCGGCCTGCGCGGGCGAGG - Exonic
1180950444 22:19718380-19718402 TTTCCCGGCGACGGCGGGCGGGG + Intronic
1180953007 22:19729197-19729219 GTGCCAGGCCACCGCTGGGGAGG - Intergenic
1180960203 22:19759078-19759100 GTGCCCTGCCACCTCGGGCTAGG + Intronic
1181283378 22:21735662-21735684 GGCCCCGGTCAGCGCGGGCTCGG + Exonic
1183939520 22:41285569-41285591 GCCCGGGGCCCCCGCGGGCGTGG + Intronic
1184386070 22:44175413-44175435 ATCCCCGGCCACCGCAGGGACGG + Intronic
949105536 3:197263-197285 GGCCTCGGCCACCGGGGGCGGGG - Intronic
949351323 3:3127175-3127197 GTTTCCGGCGACCGCAGGCGCGG + Intronic
952867065 3:37861653-37861675 GCCCCGGGCCCCCGCGCGCGCGG + Intergenic
954333558 3:49903532-49903554 GTCCTCGCCCGCCGCGGGCTTGG + Exonic
966866122 3:184260043-184260065 GGCCCAGGCGCCCGCGGGCGGGG - Exonic
968084395 3:195867963-195867985 GTCTCCAGCCCCCCCGGGCGAGG - Exonic
968084516 3:195868378-195868400 GTCCCAGTCCACCACAGGCGTGG + Exonic
968508978 4:987140-987162 GGCCGGGGCCACCGGGGGCGCGG - Exonic
968653119 4:1767728-1767750 GGCTCCGGCCGGCGCGGGCGTGG - Intergenic
968674694 4:1871271-1871293 GTCCGCGGGCCCCGCGAGCGCGG + Intergenic
978503503 4:109433677-109433699 CTCGGCGGCCGCCGCGGGCGCGG - Intergenic
981782686 4:148444924-148444946 GTCACCGGCCACCCAGGGCCCGG - Intergenic
982573176 4:157076055-157076077 GAACCTGGCGACCGCGGGCGGGG - Exonic
984639264 4:182144530-182144552 GTCCCCGGGCCGCGCGGCCGGGG + Intronic
985006007 4:185535663-185535685 CTCCCGGGCCGCGGCGGGCGCGG + Intergenic
985780677 5:1869348-1869370 GTCCCTGCCCACTGCGGGTGAGG + Intergenic
985988661 5:3537875-3537897 GTCCCCAGCCAAAGCGGGCACGG - Intergenic
986330401 5:6713237-6713259 GGCCCCGTCGGCCGCGGGCGGGG - Intergenic
990955154 5:61332814-61332836 GGCCCCGGCCCCCGCGGCGGCGG - Exonic
992042375 5:72848551-72848573 GCCCCCGGCCGCCGGGGGCTGGG - Intronic
992080897 5:73233748-73233770 GGCCCGGCCCAGCGCGGGCGGGG - Intergenic
992487588 5:77210874-77210896 GGTCCCGGCGGCCGCGGGCGCGG + Exonic
996738186 5:126776642-126776664 GTCCCCGGCCACCGCGGGCGTGG - Intronic
997304151 5:132825986-132826008 GTCCCCGGCGACTGCGTGCGCGG + Exonic
997727365 5:136132973-136132995 GTCCCCGGCGCGCGCGGGCGAGG + Intronic
998139233 5:139690538-139690560 CTCCCAGGGCAGCGCGGGCGGGG + Intergenic
1002895551 6:1378264-1378286 GCCGCCGGGCACCGCGGGCTTGG - Intergenic
1003175530 6:3750708-3750730 GTCCGCGGCAGCCGCGGGCGGGG + Intronic
1006145795 6:31958929-31958951 ATCAGCGGCCAGCGCGGGCGCGG - Exonic
1014009791 6:116462304-116462326 GTGCGCGGCCACCGGGAGCGCGG + Exonic
1015842345 6:137488915-137488937 CTCCGGGGCCACCGCGAGCGCGG + Intergenic
1016658085 6:146543781-146543803 TTCCGCGGCCGCCGGGGGCGCGG + Exonic
1018727808 6:166627185-166627207 CGCGCCGGCCACCGCGGCCGGGG + Intronic
1019298536 7:291275-291297 GGCCCCGGACAGCGCTGGCGAGG + Intergenic
1019547936 7:1587385-1587407 GTCCCTGCCCACCCCGGCCGCGG + Intergenic
1019566116 7:1679805-1679827 GTCCTTGGCCATTGCGGGCGTGG + Intergenic
1021653594 7:22854140-22854162 GCCTCCGGGCCCCGCGGGCGGGG + Intergenic
1023050779 7:36249293-36249315 GCCCCCGGCCACTGCTGGGGAGG + Intronic
1023871150 7:44263626-44263648 ATCCCCGGACACCGGAGGCGTGG + Intronic
1029604493 7:101590418-101590440 GCACCAGGCCACCGCGGGGGTGG - Intergenic
1029701372 7:102248759-102248781 GTCCTCGGGGGCCGCGGGCGCGG - Exonic
1034342737 7:150368728-150368750 GTCGCCGGCTCCCGCGGCCGCGG - Intronic
1034548930 7:151808066-151808088 AACCCCGGCCACAGCGGGCGGGG + Intronic
1035699534 8:1627383-1627405 GTCCCTGGGCACCACGGGAGGGG + Intronic
1038311682 8:26449962-26449984 GTCCCCGGCGCCCAGGGGCGGGG + Intronic
1039512814 8:38105355-38105377 GCCCGCGGCCACCGCCGGCGCGG + Exonic
1044999868 8:97869600-97869622 GACCCCGGCCACCGCGACCCAGG + Intronic
1057230623 9:93319426-93319448 GGCCCAGGCCACAGCTGGCGGGG - Intronic
1060524992 9:124315442-124315464 GCCCCCGGCCACAGTGGGTGAGG + Intronic
1061065680 9:128276207-128276229 GTCCCCGCCCACCTCGGGAGAGG + Exonic
1061231759 9:129319669-129319691 GGCCCCGGCCTCCACGGGCCCGG - Intergenic
1061307962 9:129743252-129743274 GTCCCTGGCCACTGCGGCCTCGG - Intronic
1061851348 9:133417883-133417905 GACCCCGGCCTCCCCGGGCCCGG + Exonic
1062106417 9:134757394-134757416 GTCCCAGGCCACGGGGGGCAGGG + Intronic
1062153264 9:135032328-135032350 GTCCCCGACCAGGGCGGGGGAGG - Intergenic
1062733429 9:138121522-138121544 GCCTCCGCCCACCGCGGCCGGGG - Exonic
1203772816 EBV:58114-58136 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772823 EBV:58129-58151 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772830 EBV:58144-58166 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772837 EBV:58159-58181 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1203772844 EBV:58174-58196 GGCCCCGGCCTCCGCGGCCCCGG - Intergenic
1186517459 X:10176608-10176630 GTCCCCTGCCAGCGTGGGCAGGG - Intronic
1187826091 X:23334501-23334523 GTCCCCTCTCAGCGCGGGCGGGG - Exonic
1188005489 X:25013524-25013546 GTCCCAGGCCGCGGCGGCCGCGG + Exonic
1189325681 X:40109476-40109498 GTCGCCGGCCATGGCGAGCGAGG - Intronic
1190096232 X:47483046-47483068 GGTCCCGGCCGCCGCGGGAGAGG - Intergenic
1190229972 X:48574622-48574644 TTCCCCGGTCACGGCCGGCGCGG - Intronic
1190745620 X:53320518-53320540 GGCCGCGGCCACCGCGGGAGCGG - Exonic
1192809482 X:74536378-74536400 GCCTCCGGCCACCTTGGGCGGGG + Intergenic
1196684069 X:118495886-118495908 GGCCGCGGCCGCCGCGGGCCGGG + Intronic
1200047734 X:153411581-153411603 GTCCCCAGGAAACGCGGGCGGGG - Intergenic
1200279362 X:154763256-154763278 GTCCCACGCCACCGCGGGGTGGG - Intronic