ID: 996746003

View in Genome Browser
Species Human (GRCh38)
Location 5:126846504-126846526
Sequence ATTTTAGGAGGTGCCACCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996745999_996746003 2 Left 996745999 5:126846479-126846501 CCATTGCTTGAAGTAACAACATG No data
Right 996746003 5:126846504-126846526 ATTTTAGGAGGTGCCACCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996746003 Original CRISPR ATTTTAGGAGGTGCCACCAG AGG Intergenic