ID: 996746890

View in Genome Browser
Species Human (GRCh38)
Location 5:126853654-126853676
Sequence TTCACTCTGGTGGCTGGCGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 195}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996746890_996746902 15 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746902 5:126853692-126853714 CTATTGTGTCGGAAATTGGTGGG No data
996746890_996746900 11 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746900 5:126853688-126853710 GGTGCTATTGTGTCGGAAATTGG No data
996746890_996746898 -10 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746898 5:126853667-126853689 CCAGAGTGAAGTTGATGCTTGGG 0: 1
1: 0
2: 0
3: 8
4: 116
996746890_996746903 22 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746903 5:126853699-126853721 GTCGGAAATTGGTGGGTTCTTGG No data
996746890_996746899 4 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746899 5:126853681-126853703 ATGCTTGGGTGCTATTGTGTCGG No data
996746890_996746901 14 Left 996746890 5:126853654-126853676 CCCCCGCCAGCCACCAGAGTGAA 0: 1
1: 0
2: 0
3: 16
4: 195
Right 996746901 5:126853691-126853713 GCTATTGTGTCGGAAATTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996746890 Original CRISPR TTCACTCTGGTGGCTGGCGG GGG (reversed) Intergenic
900332037 1:2140132-2140154 TGCCCTCAGGTGGCTGGCAGAGG + Intronic
900414970 1:2530645-2530667 TTCCCACTGCTGGCTGGCAGAGG + Intergenic
902477156 1:16694286-16694308 TCCACTTTGGTCGCTGGCGGGGG + Intergenic
903095884 1:20973009-20973031 TTCTCTCTCTTGGCTGGAGGCGG + Exonic
906666703 1:47627213-47627235 TTCCCTCTGCTGGCTGGAGTAGG + Intergenic
908751837 1:67430928-67430950 TTCACCGTGGAGGCTGACGGAGG - Intergenic
913216553 1:116625599-116625621 ATCACTCTGGTGGCAGGTGGAGG + Intronic
913702482 1:121386112-121386134 TTCACTCTGGTGTATGAAGGGGG + Intronic
914043045 1:144066607-144066629 TTCACTCTGGTGTATGAAGGGGG + Intergenic
914135041 1:144893881-144893903 TTCACTCTGGTGTATGAAGGGGG - Intronic
915148319 1:153808832-153808854 ATCATTCTGGGGGCGGGCGGGGG + Exonic
917196349 1:172469838-172469860 TTAACTCTGGTAGATGGCAGAGG + Intergenic
917642209 1:176994106-176994128 TTCTCATTGGTGGGTGGCGGGGG - Intronic
919657912 1:200215187-200215209 TGCACTCTGATGCCTTGCGGGGG + Intergenic
919949814 1:202352596-202352618 TTCACACTGGCGGCCGGGGGTGG + Intronic
920489911 1:206404855-206404877 TTCACTCTGGTGTATGAAGGGGG + Intronic
921326297 1:213988756-213988778 TTCCTGCTGGTGGCTGGGGGTGG + Intronic
921943155 1:220864061-220864083 TTCCCTCTGGTGCCTGGCTCGGG - Intergenic
1066304884 10:34130683-34130705 TTCACTCTGGTGGCTATGAGGGG + Intronic
1068668265 10:59698501-59698523 TTCTCTCTTCTGGCTGGCAGTGG - Intronic
1069473655 10:68714608-68714630 ATCACTCTAGTGGTTGGTGGAGG + Intergenic
1070292217 10:75125032-75125054 AGCACTCTGGTAGCTGGAGGCGG - Intronic
1072170651 10:92858028-92858050 TTCAAACTGCTGGCCGGCGGAGG - Intronic
1073624743 10:105085291-105085313 TTCCCTCTGTGGGCTGGAGGAGG + Intronic
1074686191 10:115964408-115964430 TTCAGTCTGGTAGATGGCAGTGG + Intergenic
1077339039 11:2017890-2017912 TTCACCCAGGCGGCTGGCTGAGG - Intergenic
1078537895 11:12189760-12189782 TTCCCTCTGGTGGCAGGCCTGGG - Intronic
1080026291 11:27618760-27618782 TTAACTCTAGAGGCTGGCAGAGG + Intergenic
1083491897 11:63019730-63019752 TCCTCTCTGGTGGCTGACTGGGG + Intergenic
1084765868 11:71308018-71308040 CTCACTCAGGAGGCTGGAGGTGG + Intergenic
1089095042 11:115913064-115913086 TCCCCTCTGGTGGTTGGCAGAGG + Intergenic
1089358797 11:117873041-117873063 TGCACACTGGAGGCGGGCGGCGG - Intronic
1090205117 11:124879641-124879663 TGCACTCTGGGGGCTGGAGGAGG + Intronic
1202822023 11_KI270721v1_random:73072-73094 TTCACCCAGGCGGCTGGCTGAGG - Intergenic
1096165984 12:49424758-49424780 TTGAATCTGGTGGGGGGCGGAGG - Intronic
1096992524 12:55816970-55816992 TTCTCTCTGGTGGTTGGAGATGG + Intronic
1097037484 12:56133400-56133422 TTCATTCTGAGGGTTGGCGGGGG - Exonic
1097359736 12:58645729-58645751 TTCTCTCTTGGGGGTGGCGGGGG + Intronic
1098114152 12:67156555-67156577 TCCATTCTGATGGCTGGTGGGGG + Intergenic
1098981638 12:76962780-76962802 CTCTCTCTGGAGGCTGGCTGTGG - Intergenic
1100686566 12:96992735-96992757 TTCCTTGTGGTGGGTGGCGGGGG - Intergenic
1101867054 12:108528053-108528075 TTGTCTCTGGTGGCTGGGCGCGG - Intronic
1103052412 12:117791643-117791665 GTCACTCTGGCTGCTGGAGGAGG + Intronic
1103405329 12:120671046-120671068 TTCAATCTGGTGGGTGGGTGTGG + Intergenic
1103930555 12:124448538-124448560 TTCACCAGCGTGGCTGGCGGGGG - Intronic
1104166174 12:126231844-126231866 TTCACTCATGTAGCTGGCGGAGG + Intergenic
1104426441 12:128682157-128682179 TTCACTCTTCTGGCTGGAGGCGG + Intronic
1107372607 13:39768850-39768872 TTCCCTCTGATGGTAGGCGGGGG - Intronic
1108102678 13:46974095-46974117 TTCCCTCTGGTGTCTGTCTGTGG - Intergenic
1109378431 13:61526153-61526175 TTCACTCTGGTCCCATGCGGCGG + Intergenic
1110220012 13:73062099-73062121 TTCACTCTGGTGGCTGAAAATGG - Exonic
1110432245 13:75437861-75437883 CTCTTTCTGGTGGCTGGCAGAGG + Intronic
1113604759 13:111597421-111597443 TTTATTCTGGGGGCCGGCGGAGG - Intronic
1113625189 13:111789710-111789732 GTCACTCTGGTGGTGGGGGGAGG - Intergenic
1114073438 14:19132883-19132905 TTCCCCATGGTCGCTGGCGGTGG + Intergenic
1114088827 14:19267100-19267122 TTCCCCATGGTCGCTGGCGGTGG - Intergenic
1117338146 14:54772370-54772392 TTCACTCTGGTTGCCAGCAGTGG + Intronic
1119414357 14:74459742-74459764 TGGCCTCTGGTGGCTGGTGGCGG - Intergenic
1121762891 14:96460793-96460815 TTCACTCTGGTCCCTGGCCCTGG + Intronic
1124365588 15:29069025-29069047 TTCACTGTGGGGGCTGGGGGCGG - Intronic
1127425933 15:58856685-58856707 ATCACTCTGTTGGCTGAAGGAGG + Exonic
1129225497 15:74168187-74168209 CTCTGTCTGGTGGCTGGGGGTGG + Intergenic
1129776635 15:78241226-78241248 CACACTGTGGTGGCTGCCGGAGG - Intronic
1132790443 16:1683544-1683566 TCCACTCAGGAGGCTGGGGGAGG - Intronic
1133221685 16:4321638-4321660 TTCACTCTGGTGGATGGGGTGGG + Intronic
1134116605 16:11553471-11553493 TTCTCTCTGGGTGCTGGCGGGGG - Intronic
1134153873 16:11826729-11826751 GTCACTCTGGAGGCTGAGGGAGG - Intergenic
1134900309 16:17932235-17932257 TTCATCCAGGTGGCTGGTGGGGG - Intergenic
1136077011 16:27824099-27824121 TTCACTCTGGGGTCTGGTGAGGG + Intronic
1136521933 16:30802417-30802439 TTCTCTCTGGTGGCCGGGTGTGG - Intergenic
1137754393 16:50889841-50889863 CTCATTCTGGAGGCTGCCGGAGG + Intergenic
1137810551 16:51349044-51349066 TTCACTATGGTATCTGGCTGCGG - Intergenic
1138334290 16:56240373-56240395 TTGCCTCTGGTGTCTGGCTGGGG + Intronic
1139563322 16:67757439-67757461 GTCACTCTTGAGGCTGGCTGTGG + Intronic
1139626279 16:68191556-68191578 TGCATTCTGGTGGCTGGAGACGG - Exonic
1139898977 16:70311871-70311893 TTCACTCTGTTGCCAGGCTGGGG + Intronic
1141621948 16:85241001-85241023 TCCAGTCTGGAGGCTGGAGGAGG + Intergenic
1142252069 16:88996544-88996566 TCTGCTCTGGTGGCTGGCGTGGG + Intergenic
1142660199 17:1423786-1423808 ATCAGTCTGGTGGCTGGGGCTGG - Intronic
1143184202 17:5000607-5000629 TTAGCTTTGGTGGCTGGAGGGGG + Intronic
1146775179 17:35607878-35607900 TTCACTCTAGTGCCAGGCAGAGG - Intronic
1146935379 17:36809712-36809734 TTCACCCTGGTAGGTGGGGGAGG + Intergenic
1149890184 17:60382225-60382247 GCCACTGTGCTGGCTGGCGGAGG - Intronic
1153344623 18:4012171-4012193 TTCACTCCCTTGGCTGGGGGAGG - Intronic
1153976882 18:10276723-10276745 TTCACTCTTTTTGCTGGTGGAGG + Intergenic
1155499048 18:26469013-26469035 TCCGCTCTGGTGGCTGGTGATGG - Intronic
1155923482 18:31629270-31629292 TGCATTCCGGTGGCTGGGGGAGG + Intronic
1156128245 18:33934893-33934915 CTCACTCTGTTGCCTGGAGGCGG + Intronic
1157158621 18:45291714-45291736 TTCATTCTTGTGGCAGGGGGAGG - Intronic
1158385652 18:56988086-56988108 TTAAATCTGGTGGCTGAAGGAGG - Intronic
1158513675 18:58113537-58113559 GACACTGTGGTGGCTGGAGGGGG + Intronic
1160279232 18:77471592-77471614 TTCACTCTGGTAGTTTGCAGTGG + Intergenic
1160544772 18:79645556-79645578 TTCACTCTGGAGCCTGGCCGAGG + Intergenic
1161007585 19:1944233-1944255 TTCTCTCGTGTGGCTGCCGGCGG - Intronic
1161396911 19:4049534-4049556 TGCCCTCTCGAGGCTGGCGGCGG + Intronic
1162464209 19:10830833-10830855 GACACCCTGGTGGCTTGCGGAGG + Intronic
1162722728 19:12672197-12672219 CTCCCTCTGGTGGCTGTGGGGGG + Intronic
1164955021 19:32375294-32375316 TTCACTGTGGCGGCTGTCTGGGG - Intronic
1167090856 19:47342697-47342719 ATCCCTCTGGTTGCTGGTGGAGG + Exonic
1167905603 19:52658104-52658126 TTCACTCTGGTTGCCGAGGGTGG - Intronic
1167920681 19:52780696-52780718 TTCACTCTTGTGGCTGAGGCTGG - Intronic
1168057893 19:53873680-53873702 TTCTCGCTGGTGGCTAGCGTGGG + Exonic
1202711172 1_KI270714v1_random:20112-20134 TCCACTTTGGTCGCTGGCGGGGG + Intergenic
925894817 2:8463094-8463116 TGCACTCGGGAGGCTGGAGGAGG + Intergenic
929179396 2:39018731-39018753 TTTACTGTGGTGGTTGGGGGTGG - Intronic
929322339 2:40559298-40559320 TTCACTCTGGTGGCCTACGGGGG - Intronic
929870906 2:45758591-45758613 TTCAATATAGTGGCTGGCGAAGG - Intronic
930236400 2:48892795-48892817 TTCACTCTGAGGGCTGTAGGGGG - Intergenic
932485161 2:72080366-72080388 ATCACACTGGTGGCTGAAGGGGG + Intergenic
932776355 2:74530312-74530334 TTCGCGCGCGTGGCTGGCGGTGG + Exonic
935181969 2:100699649-100699671 GTCGCTCTGATGGCTGGGGGTGG + Intergenic
935529761 2:104218057-104218079 TTCACTCCTGTGGCTGGCAGTGG - Intergenic
937734780 2:125276379-125276401 TTCTCTCAGGTGGGTGGAGGAGG + Intergenic
939779001 2:146421816-146421838 TTCACTCTTGTGGCTGAAGCTGG + Intergenic
940974150 2:159924715-159924737 TTTACTCTGGGGGCTGGGGGGGG + Intergenic
943619354 2:190130976-190130998 TTCACTCTGGTCTCTGGCCATGG - Intronic
944560361 2:200929868-200929890 TTCACTCTGCTGGATAGCAGGGG + Intronic
948178229 2:235960469-235960491 TTCTCTGGGGTGGCTGGAGGTGG + Intronic
1169455194 20:5746456-5746478 TTCATGCAGCTGGCTGGCGGTGG + Intergenic
1170571495 20:17635337-17635359 GTCCCTGTGGTGGCTGGTGGTGG - Intronic
1172466754 20:35161106-35161128 TTCACTCTGCAGGCTGGGCGCGG + Intergenic
1173041889 20:39472095-39472117 TTTAATCTAGTGGTTGGCGGGGG - Intergenic
1178136341 21:29631590-29631612 TTCATTATGGTAGCTGGAGGTGG + Intronic
1178439930 21:32590519-32590541 TTCGTTCTGGAGGCTGGAGGTGG - Intronic
1178851216 21:36213828-36213850 TTCACCCTGTTGGCTGGGCGCGG - Intronic
1179640860 21:42746435-42746457 TGGCCTCTGGTGGCTGCCGGCGG + Intronic
1180491881 22:15855236-15855258 TTCCCCATGGTCGCTGGCGGTGG + Intergenic
1180676214 22:17588172-17588194 TGCAATCTGGCTGCTGGCGGAGG + Intronic
1180709538 22:17830583-17830605 CTCACTCTGCTGGCTAGCAGAGG + Intronic
1180817909 22:18803970-18803992 ATCACTCTGGTGGCAGGTGAAGG + Intergenic
1181204123 22:21238425-21238447 ATCACTCTGGTGGCAGGTGAAGG + Intergenic
1181355957 22:22295823-22295845 CTCACTGTGGTTGCTGGTGGTGG - Intergenic
1182148237 22:28010675-28010697 ATCACTGTGCTGGCTGGCAGAGG + Intronic
1183372310 22:37440492-37440514 TTATCTCAGGTGGCTGGTGGTGG + Intergenic
1184399477 22:44265430-44265452 CTCACTCAGGTGGCTGGTAGCGG - Intronic
1203222797 22_KI270731v1_random:56990-57012 ATCACTCTGGTGGCAGGTGAAGG - Intergenic
1203268032 22_KI270734v1_random:29823-29845 ATCACTCTGGTGGCAGGTGAAGG + Intergenic
949757000 3:7423643-7423665 TTCTCTTTGGTGGGTGGGGGTGG - Intronic
949880737 3:8658658-8658680 TTGACGCTGGGGCCTGGCGGGGG - Intronic
949962859 3:9328732-9328754 TTCACACTGGTGGTTGGGGTTGG - Intronic
950502494 3:13373218-13373240 TTCACAATGGTGGCAGGTGGTGG - Intronic
951332715 3:21385685-21385707 TTTAATCTGGTGGTTGGTGGAGG - Intergenic
951695099 3:25438096-25438118 CTCACTCTCATGGCTGGTGGTGG + Intronic
953287858 3:41630260-41630282 TCCAGTCTGGAGGCTGGAGGTGG + Intronic
954782678 3:53072836-53072858 TGCCCTCTAGTGGCTGCCGGCGG + Intronic
960327671 3:116317118-116317140 TTACCTCTGGTGGCTGGGGATGG - Intronic
963028054 3:140939656-140939678 TCCACTCTGGGGCCTGTCGGGGG + Intergenic
964614255 3:158645093-158645115 TTTACTCTGGTGGCAGGGGATGG - Intronic
973192502 4:47401533-47401555 TTCTCTCTAGTGGCTGAGGGGGG + Intronic
975198364 4:71553589-71553611 TTCAATTTGGTGGGTGGTGGGGG - Intronic
979490721 4:121324475-121324497 TTCACTCTCTTGACTGGTGGTGG + Intergenic
979840038 4:125427009-125427031 TTCACTCAGGAGGCAGGCAGAGG + Intronic
982384109 4:154781519-154781541 TACACAGTGGGGGCTGGCGGCGG + Intronic
982811019 4:159826029-159826051 TTCTCTTTAGTGGCTGGCTGGGG + Intergenic
985776744 5:1848326-1848348 TTCACTTTGATGGCAGGAGGAGG + Intergenic
987300918 5:16597627-16597649 GTCACTCTTGTGGGTGGGGGAGG - Intronic
990626512 5:57618677-57618699 TTCACTCTGGTGGTTGATGCTGG - Intergenic
994383208 5:99096491-99096513 TTCCTTCTGGTGGCTGTAGGGGG + Intergenic
996482813 5:123994187-123994209 TTCACGTTGGTGGCTGTGGGTGG + Intergenic
996746890 5:126853654-126853676 TTCACTCTGGTGGCTGGCGGGGG - Intergenic
998034158 5:138899688-138899710 TTTCCTCTGGTGGGTGGTGGGGG - Intronic
1000345781 5:160312425-160312447 TGCCCTCTGGTGCCTGCCGGCGG + Exonic
1001629789 5:173166413-173166435 TTAACCCTGGTGGCTGGTGGAGG - Intergenic
1002666670 5:180830573-180830595 TTTACTCGGGTGGCTGGGTGAGG + Intergenic
1002666686 5:180830673-180830695 TTTACTCGGGTGGCTGGGCGAGG + Intergenic
1003414899 6:5898790-5898812 TTCACTCAGGAGGCCGGTGGTGG - Intergenic
1004313402 6:14565481-14565503 TTCACTGTTTTGGCTGGGGGTGG - Intergenic
1005797425 6:29380326-29380348 CTCACTCTGGTGTCTGTGGGTGG - Intronic
1005982588 6:30847824-30847846 TCCACACTTGTGGCTGGCGGCGG - Intergenic
1006027777 6:31158277-31158299 TTCACTCTGTTGGGAGGAGGGGG + Intergenic
1007462588 6:42029368-42029390 TTGAGTCTGCTGGCTGGCAGTGG + Intronic
1008646457 6:53519423-53519445 TGGACTCTGGTGGGTGGAGGGGG - Intronic
1008956615 6:57222365-57222387 TTCTGGCGGGTGGCTGGCGGCGG + Intergenic
1018132983 6:160750004-160750026 CTCATCCTGGTGGTTGGCGGTGG - Intronic
1022569913 7:31442187-31442209 TCCACTCTGCTGGCTCCCGGAGG + Intergenic
1023872300 7:44269620-44269642 TTTCTCCTGGTGGCTGGCGGGGG - Intronic
1024820186 7:53319531-53319553 TTCACTCTGGTGGCTTGTCTTGG - Intergenic
1025763340 7:64415764-64415786 TTCTGTGTGGTGGCTGGTGGGGG + Intergenic
1026404730 7:70053403-70053425 TTCACTTTGGTGCCTGGCCCAGG - Intronic
1029142039 7:98418200-98418222 TTTACTCTGCTGGCTGGGAGCGG - Intergenic
1031498285 7:122479111-122479133 GTCACTCTGGTGTCTGGGAGTGG + Intronic
1034693185 7:153030389-153030411 TTCACCATGTTGGCTGGCTGGGG + Intergenic
1034845479 7:154440509-154440531 TTCACAATGCTGGCTGGAGGTGG - Intronic
1036997926 8:13680925-13680947 CTCACTCTGTTGCCTGGCTGGGG + Intergenic
1040906435 8:52474008-52474030 GTCTATCTGGTGGCTGCCGGTGG - Intergenic
1043286439 8:78537596-78537618 TGCACTCTAGTTGTTGGCGGTGG - Intronic
1047395020 8:124489608-124489630 TTCACTATGTTGGCTGGCCGTGG + Intronic
1047892708 8:129330344-129330366 TTCACTCTGGGGGATGGAGCTGG + Intergenic
1048461318 8:134623844-134623866 TGCTCTCTGGTGGCTCGCTGGGG - Intronic
1048549597 8:135422104-135422126 TTCACTCTGGGGGTTGTCTGGGG - Intergenic
1048851258 8:138647215-138647237 TTCACTCTTGTGGCTGTTGATGG - Intronic
1049389486 8:142360622-142360644 TTCAGGCTGGTGGGGGGCGGGGG - Intronic
1053391675 9:37740669-37740691 GTCACTCAGGTAGCTGGCCGGGG - Exonic
1055644483 9:78350015-78350037 TTCACTCTTGTGGCCGGGCGCGG - Intergenic
1057007037 9:91569287-91569309 CTCACTCTGGCAGCTGGTGGAGG + Intronic
1059416908 9:114168057-114168079 GTCACTCTGGTGACTGCCTGCGG + Exonic
1060225083 9:121785624-121785646 TTCACTCTGGTGGCATTCGTGGG + Intergenic
1061273604 9:129557637-129557659 TTCAGGCTGGAGGCTGGTGGGGG - Intergenic
1061732934 9:132630710-132630732 TTCACTGTGGTGACTGGATGAGG + Intronic
1062542055 9:137045873-137045895 CTCACCCGGGTGGCCGGCGGCGG + Exonic
1185645616 X:1613672-1613694 ATCACTCTGGAGGCTGGGAGTGG + Intergenic
1187716857 X:22111217-22111239 TTCACTCTGAGGGCTGGAGCTGG + Intronic
1189272541 X:39761385-39761407 CTCACTCTGGTGGCTTGCTCTGG - Intergenic
1189857826 X:45240967-45240989 ATCACTCTGTTTGCTGGAGGAGG + Intergenic
1190735266 X:53251503-53251525 TTTACTCTGGGGGATGGCAGAGG - Intronic
1192558401 X:72108543-72108565 TTCGCTCTGCTGCCTGGGGGCGG + Intergenic
1195774843 X:108391632-108391654 TTCCCTCTGGTGCCTGGCTCGGG - Intronic
1197769712 X:130082340-130082362 CGCTCTCTGGTGGGTGGCGGCGG - Intronic
1198278075 X:135116242-135116264 TCCACGCTGGTGGATGGAGGAGG + Intergenic
1198292887 X:135256274-135256296 TCCACGCTGGTGGATGGAGGAGG - Intronic
1200268656 X:154660714-154660736 GTCACTCTGTTGGTTGTCGGGGG - Intergenic
1201153101 Y:11104944-11104966 TTCACTCTTGTGGCTGAAGTGGG + Intergenic