ID: 996749283

View in Genome Browser
Species Human (GRCh38)
Location 5:126872825-126872847
Sequence GATCCACTTTAGCATGTTCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 95}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996749283 Original CRISPR GATCCACTTTAGCATGTTCA GGG (reversed) Intronic
903753352 1:25644003-25644025 GTTCCACTTCAGCTTTTTCAGGG + Intronic
910027826 1:82679651-82679673 GAGCTAATTTAACATGTTCAAGG + Intergenic
922976920 1:229792893-229792915 TATCCACGTTTGCATGCTCAGGG + Intergenic
1065350766 10:24793812-24793834 GATCCACTTTTGCTTCTCCAGGG - Intergenic
1068936599 10:62641052-62641074 AATTCACATTAGCATTTTCAAGG - Intronic
1069031802 10:63604125-63604147 GAACCACCTGAGCATGTTAAAGG + Intronic
1077588654 11:3474578-3474600 GATCCAATTGAGCATGTAGATGG + Intergenic
1081824999 11:46041317-46041339 GATCTTATTTAGGATGTTCAAGG + Intronic
1082582624 11:54891837-54891859 GATATACGTTTGCATGTTCAAGG - Intergenic
1084244356 11:67846207-67846229 GATCCAATTGAGCATGTAGATGG + Intergenic
1084828336 11:71748356-71748378 GATCCAATTGAGCATGTAGATGG - Intergenic
1086606827 11:88705519-88705541 GATGCACTATAGCATGGTGAAGG + Intronic
1088085933 11:105980139-105980161 GACACAGGTTAGCATGTTCACGG - Exonic
1088803021 11:113324247-113324269 CATCCAATTTACCCTGTTCAAGG + Intronic
1090027567 11:123180838-123180860 AAACCACTTTGGCATCTTCAAGG + Intronic
1092414919 12:8283349-8283371 GATCCAATTGAGCATGTAGATGG + Intergenic
1093057530 12:14569641-14569663 GAACCACATTAGGATGTTCAAGG + Intergenic
1102399539 12:112616449-112616471 GATCCATTCTTGAATGTTCATGG + Intronic
1104293317 12:127488552-127488574 GATCCAGTTGAGCATGTAGAAGG - Intergenic
1106501926 13:30337103-30337125 GTGGCACTTTAGCATGTTAAAGG - Intergenic
1110850828 13:80242461-80242483 GATCCACTGGAGGATCTTCAGGG - Intergenic
1116103777 14:40474545-40474567 GGTCCACTTTAGCTGGTTAAAGG + Intergenic
1121629887 14:95414231-95414253 GACCCACTTCAGCATGAGCAAGG + Intronic
1121856932 14:97278770-97278792 GAGGCACATTAGCATGTTAAAGG - Intergenic
1130077981 15:80706255-80706277 GATTCACTTTAGAGTGTTAAAGG + Intronic
1130202717 15:81847233-81847255 AACCCACTTTAGCCTGTTGAAGG - Intergenic
1130205081 15:81868340-81868362 GATACAATTGAGCATGTTTATGG - Intergenic
1135518100 16:23151959-23151981 GATTCACTACAGAATGTTCAAGG - Intergenic
1137991087 16:53156240-53156262 GATTCACTGAACCATGTTCAAGG + Exonic
1142994617 17:3753330-3753352 GCTCCATTTTACCACGTTCATGG - Exonic
1144417358 17:15062934-15062956 GATACAGTATACCATGTTCATGG + Intergenic
1147759074 17:42785870-42785892 TTTCCACTTCAGCATGTTCTCGG + Intronic
1149580090 17:57743814-57743836 GAACCACTTCAGGCTGTTCATGG - Intergenic
1149920110 17:60649870-60649892 GATTCAGTTTTACATGTTCAGGG + Intronic
1150879876 17:69012534-69012556 GATCCTCTTTAATATGTACAGGG - Intronic
1152116096 17:78388257-78388279 GACCCACTTTGGCAGGTACAGGG - Intronic
1152404549 17:80089173-80089195 GAAGCACTTTAGTATTTTCATGG + Intronic
1152858692 17:82681865-82681887 GATGCACTTTATCAGGTTAAGGG - Intronic
1152986465 18:325933-325955 GATCAACTTTGACATGTTCCTGG + Intronic
1154031739 18:10759088-10759110 CATCCACTGTCCCATGTTCAGGG + Intronic
1163952771 19:20605970-20605992 GTTCCAGCTTAGCATTTTCAGGG + Intronic
1168037897 19:53734814-53734836 TATCCACTTTAACCTGGTCAAGG + Intergenic
925419586 2:3701572-3701594 AATCCACTTTTGCCTGATCACGG - Exonic
936986155 2:118312843-118312865 GGCCCACTTTAGGATGTTAATGG - Intergenic
945577493 2:211549941-211549963 GTTCCACTTTATCATGTATAAGG - Intronic
947272842 2:228357142-228357164 AATCCAATTTAGCATCTTGACGG - Intergenic
1174637355 20:52013263-52013285 GAACCAGCTTGGCATGTTCAAGG + Intergenic
1175014226 20:55771350-55771372 GCCCCACTTTTACATGTTCATGG + Intergenic
1177862236 21:26468247-26468269 GATCCACCTAAGCACATTCAGGG - Exonic
1178213634 21:30568362-30568384 GAGCCACTTTAACTTGTTAATGG + Intergenic
959541180 3:107540473-107540495 GATCCACTCCAGCAGGCTCAGGG - Intronic
960919392 3:122731275-122731297 GAGCCACCTTAAAATGTTCATGG + Intergenic
961892466 3:130141960-130141982 GATCCAATTGAGCATGTAGATGG + Intergenic
964391379 3:156201499-156201521 GGTCCACTGTAGCATAGTCAGGG + Intronic
968467843 4:761830-761852 GACCCACACTGGCATGTTCATGG - Intronic
968697114 4:2036602-2036624 GCTCCACTACAACATGTTCAGGG + Intronic
968988453 4:3892688-3892710 GATACACTTTCTCATGTCCAGGG + Intergenic
969750297 4:9105182-9105204 GATCCAATTGAGCATGTAGATGG - Intergenic
970432541 4:16001928-16001950 GATCCATTTTATCAGGATCAGGG + Intronic
975478559 4:74851314-74851336 CATCCACTCGAGCATGATCATGG - Intergenic
979888074 4:126057267-126057289 GATTCATTTTTGCATGTTTAGGG + Intergenic
980191114 4:129526345-129526367 GATGCACATTAGCATATTAATGG + Intergenic
996749283 5:126872825-126872847 GATCCACTTTAGCATGTTCAGGG - Intronic
997666349 5:135632450-135632472 GGTAAACTTTAGCATGCTCAGGG + Intergenic
997747690 5:136313855-136313877 GATCCAAACTATCATGTTCATGG + Intronic
999565965 5:152862006-152862028 GATTAACTTCAGGATGTTCATGG + Intergenic
1002080977 5:176737260-176737282 GATCCATTTGAGCAGTTTCAGGG + Intergenic
1003906787 6:10708077-10708099 GATTTAATTTAGCATGTTCATGG + Intronic
1005481417 6:26258797-26258819 AATCCACATTAACATTTTCATGG - Intergenic
1007639167 6:43323184-43323206 GATGCCCTTTATCATGTTGAAGG - Intronic
1008154708 6:47999682-47999704 CAACCACTTTATTATGTTCATGG - Intronic
1008327272 6:50198268-50198290 CAACCACTTTACTATGTTCATGG + Intergenic
1009478698 6:64128330-64128352 GCTCCATTTTAGAAAGTTCATGG - Intronic
1010796220 6:80119650-80119672 GATGCCATTTAGAATGTTCATGG - Intronic
1010832888 6:80552585-80552607 GATTAACTTTAGCCTATTCATGG - Intergenic
1011048698 6:83117635-83117657 TATCCACTATTGCATGATCAGGG + Intronic
1012793571 6:103732899-103732921 TATGCACTGTAGCATCTTCATGG + Intergenic
1013694132 6:112681319-112681341 GAGACACTTTACCATGTCCATGG - Intergenic
1014885545 6:126776443-126776465 GATTATGTTTAGCATGTTCAAGG + Intergenic
1015760513 6:136654849-136654871 GTTCCTATTTGGCATGTTCATGG + Intronic
1018273602 6:162106670-162106692 GAACAACTTTAACAAGTTCACGG + Intronic
1020322680 7:6951463-6951485 GATCCAATTGAGCATGTAGATGG + Intergenic
1020413852 7:7923602-7923624 GCTTTACTTTAGCATTTTCAGGG + Intronic
1022092466 7:27116501-27116523 GACTCACTTTAGCACTTTCATGG + Intronic
1022206494 7:28169270-28169292 GCTCCACTTCAGCACTTTCAGGG - Intronic
1027599710 7:80224605-80224627 GATGCACATTAGCATGTCAATGG + Intergenic
1030327788 7:108239587-108239609 GAGCCACTTTAAAATGATCATGG - Intronic
1030912619 7:115270653-115270675 CATCCACTTTACTATGCTCATGG - Intergenic
1035690981 8:1559674-1559696 GATTCACTTTGGCAGGTTTATGG - Intronic
1036373377 8:8179516-8179538 GATCCAGTTGAGCATGTAGATGG - Intergenic
1036877530 8:12486125-12486147 GATCCAGTTGAGCATGTAGATGG + Intergenic
1039278788 8:35959244-35959266 GATCCAGTTGAGCATGTAGATGG - Intergenic
1042220297 8:66466846-66466868 GGTCAACGTTAGCATATTCAAGG + Intronic
1043595750 8:81882683-81882705 GATTAATTTTAGCATGTACATGG + Intergenic
1045827358 8:106414445-106414467 GATCTCATTTAACATGTTCAAGG + Intronic
1061567878 9:131455805-131455827 AGTGTACTTTAGCATGTTCAAGG - Intronic
1190314359 X:49140517-49140539 GATCCAGTTGAGCATGTAGATGG + Intergenic
1200284912 X:154811268-154811290 AATCCAATTTACCATATTCATGG + Intronic