ID: 996761241

View in Genome Browser
Species Human (GRCh38)
Location 5:126987865-126987887
Sequence AAACCCATGATTTTACTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 155
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 144}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996761229_996761241 17 Left 996761229 5:126987825-126987847 CCTCCCCTACTCCCTGCCTTAGG 0: 1
1: 0
2: 3
3: 34
4: 390
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761234_996761241 6 Left 996761234 5:126987836-126987858 CCCTGCCTTAGGTCCATGCACTG 0: 1
1: 0
2: 1
3: 6
4: 133
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761227_996761241 27 Left 996761227 5:126987815-126987837 CCCTCACTCTCCTCCCCTACTCC 0: 1
1: 2
2: 14
3: 193
4: 1694
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761236_996761241 1 Left 996761236 5:126987841-126987863 CCTTAGGTCCATGCACTGCACTA 0: 1
1: 0
2: 0
3: 7
4: 92
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761226_996761241 28 Left 996761226 5:126987814-126987836 CCCCTCACTCTCCTCCCCTACTC 0: 1
1: 0
2: 13
3: 163
4: 1528
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761233_996761241 12 Left 996761233 5:126987830-126987852 CCTACTCCCTGCCTTAGGTCCAT 0: 1
1: 0
2: 1
3: 15
4: 179
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761235_996761241 5 Left 996761235 5:126987837-126987859 CCTGCCTTAGGTCCATGCACTGC 0: 1
1: 0
2: 0
3: 5
4: 132
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761231_996761241 14 Left 996761231 5:126987828-126987850 CCCCTACTCCCTGCCTTAGGTCC 0: 1
1: 0
2: 0
3: 26
4: 264
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761232_996761241 13 Left 996761232 5:126987829-126987851 CCCTACTCCCTGCCTTAGGTCCA 0: 1
1: 0
2: 1
3: 22
4: 184
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761228_996761241 26 Left 996761228 5:126987816-126987838 CCTCACTCTCCTCCCCTACTCCC 0: 1
1: 0
2: 24
3: 289
4: 2059
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144
996761237_996761241 -7 Left 996761237 5:126987849-126987871 CCATGCACTGCACTAGAAACCCA 0: 1
1: 0
2: 2
3: 5
4: 146
Right 996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG 0: 1
1: 0
2: 1
3: 9
4: 144

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996761241 Original CRISPR AAACCCATGATTTTACTTGG GGG Intronic
903792051 1:25900224-25900246 AATCTCAAGATTCTACTTGGTGG - Intronic
906733879 1:48105728-48105750 AACCCCATGATTGTACAAGGGGG - Intergenic
906734232 1:48109037-48109059 AAACCCATGATTTTCACTGCGGG + Intergenic
906928808 1:50148229-50148251 AAAAGCATGATTTTATTTGGAGG + Intronic
907702112 1:56798893-56798915 TAACCCAAGAATTTGCTTGGTGG + Intronic
909030627 1:70534975-70534997 AAACCCATGACTTTGCTGGGGGG - Intergenic
910387065 1:86695763-86695785 ATGCCCATGTTTTTACTTTGAGG - Intergenic
915886492 1:159727854-159727876 AAGTCTATGAATTTACTTGGAGG - Intergenic
916167597 1:161977714-161977736 ATCCCCATGAATTTATTTGGTGG - Intergenic
917430767 1:174966104-174966126 CATCCTATGACTTTACTTGGAGG + Intronic
918029747 1:180794582-180794604 GAAGCCTTGAATTTACTTGGAGG + Intronic
919777662 1:201204898-201204920 TAGCCCCTCATTTTACTTGGGGG + Intronic
922642984 1:227254542-227254564 AGAAACATGAGTTTACTTGGTGG - Intronic
923064997 1:230509536-230509558 TAACCCCTCATTTTAGTTGGAGG - Intergenic
1062777044 10:160091-160113 AAAGCCATCATTTTACTTAATGG - Intronic
1062803970 10:401250-401272 AATCCTATGATTTTACATGTGGG + Intronic
1065587550 10:27234411-27234433 AAAGCCATTATTTTTCTTGCAGG + Intronic
1069310207 10:67025349-67025371 AAAACCATGTTTTTAGTTTGGGG - Intronic
1070078590 10:73163130-73163152 AAACCCAGGATTAAACTAGGAGG - Intronic
1074647419 10:115474683-115474705 TAACACTTGATTTTACTTAGTGG - Intronic
1076724252 10:132405990-132406012 AGATCCATGGTTTTCCTTGGTGG + Exonic
1077848148 11:6047605-6047627 AAAACCATGATTTTATTTTGGGG + Intergenic
1077848856 11:6054875-6054897 AAGCCCATGATTTTCCTTCTAGG + Intergenic
1078788333 11:14518981-14519003 AAAAACATTATTTTACCTGGGGG + Exonic
1079813069 11:25020196-25020218 AAAAGGATGATTTTACTTTGGGG + Intronic
1080983827 11:37437793-37437815 TAATCAATGATATTACTTGGGGG + Intergenic
1083516655 11:63265329-63265351 AAACCCATAATTTTACAGGAAGG + Intronic
1092759274 12:11794744-11794766 AAAACCATTATTTTACTTGGTGG + Intronic
1093065072 12:14649222-14649244 AAACACCTGTTTTTACTGGGTGG - Intronic
1093235165 12:16601262-16601284 AAACTCATTTTTTTACTTGTAGG - Intronic
1094707512 12:32928640-32928662 AAAAACATGATTTGACATGGAGG + Intergenic
1095159052 12:38894054-38894076 TGACCTATGATATTACTTGGAGG - Intronic
1103235600 12:119369927-119369949 AAATCCCTGATTTTAGGTGGTGG - Intronic
1103660261 12:122508969-122508991 AAACCCATTTATTTACTTTGAGG + Intronic
1104043070 12:125143095-125143117 AAACCCGTGACTTGACTTAGGGG - Exonic
1105835100 13:24203170-24203192 AATCCCATCATTTCACATGGAGG - Intronic
1109419623 13:62094401-62094423 AAACCTATGTTTCTATTTGGTGG - Intergenic
1116623225 14:47232802-47232824 AAACCCATGAGTTTAAATGATGG + Intronic
1123682440 15:22772406-22772428 AAACCCATTCTTTTGGTTGGGGG + Intergenic
1123807572 15:23890136-23890158 AACCCCATGATTTTACAGTGAGG + Intergenic
1126188084 15:45850134-45850156 AAACCATTGATTTTCCTTGGAGG + Intergenic
1127681673 15:61303851-61303873 AAACCCTTGGTGTTCCTTGGTGG + Intergenic
1129579479 15:76792043-76792065 AAACCAATAATTTTAGCTGGAGG + Intronic
1130927045 15:88393393-88393415 AACACCATGATTTTCCTTTGAGG + Intergenic
1131557408 15:93411936-93411958 AAGACCATGAGTTGACTTGGTGG - Intergenic
1131585799 15:93691516-93691538 AAACCAGTGAGTTTACTTGAAGG + Intergenic
1131643739 15:94319632-94319654 AAACCCATGCTTCTCCTTAGAGG + Intronic
1132017108 15:98327835-98327857 AAAGCCATGTTTTTATTTTGTGG - Intergenic
1135983016 16:27163240-27163262 AAACCCCTAACTTTAGTTGGAGG + Intergenic
1137961825 16:52888785-52888807 AGCACCATGATTTTCCTTGGGGG - Intergenic
1138085781 16:54132554-54132576 AAACCAAAGAATTTACTTGCTGG + Intergenic
1141897621 16:86968658-86968680 AAACCCATGAATGTGCTAGGAGG + Intergenic
1143403941 17:6664312-6664334 AATCCCATTGTTTTACTTTGAGG + Intergenic
1146528775 17:33590193-33590215 AGACCCAGGATGTTCCTTGGTGG - Intronic
1155853104 18:30796977-30796999 TAAACCATGATGTTCCTTGGTGG - Intergenic
1155908864 18:31486087-31486109 AAACCCACTATTTTACTTCCAGG + Intergenic
1160062644 18:75546894-75546916 AAACTCAAGCTTTTATTTGGAGG + Intergenic
1160211467 18:76883945-76883967 AAAGCAATAATTTTACATGGCGG - Intronic
1162585830 19:11557872-11557894 AAGCCCATGAGTTTAATTGTTGG + Intronic
1163760638 19:19134681-19134703 AAAGCCTTGATTTTGGTTGGTGG - Intronic
1164084736 19:21890537-21890559 AAACCCATAATTGTATTTGTGGG - Intergenic
1168439444 19:56351343-56351365 GAACACATGGTGTTACTTGGAGG - Intronic
925051010 2:815285-815307 ATGCCCATGATTTTAGTTGTTGG - Intergenic
925237313 2:2291352-2291374 AAGCCCATGATTTTACAGGTTGG + Intronic
926345871 2:11944378-11944400 AAACCCCTAATTTTAGTTGTTGG - Intergenic
928340730 2:30441074-30441096 AAACCCCTTCTTTTTCTTGGTGG - Intergenic
936790576 2:116146272-116146294 AAACACTTAATATTACTTGGAGG - Intergenic
938753683 2:134360422-134360444 AAACCCATTGTTTCACTTGCTGG + Intronic
939056350 2:137369521-137369543 AAATCCAAGATTATATTTGGGGG + Intronic
939217443 2:139257304-139257326 AAGTCCATGAATTTATTTGGAGG - Intergenic
942361005 2:175171423-175171445 AAACCCAAGATTTGGGTTGGAGG - Intergenic
942537537 2:176981129-176981151 AAATCCATTAGTTTACTTGCTGG + Intergenic
945708842 2:213270481-213270503 AATTCTGTGATTTTACTTGGAGG + Intergenic
946523261 2:220489632-220489654 GAACCCATGCTATTAATTGGAGG - Intergenic
1170212671 20:13860898-13860920 AAACTGATGATTTTGTTTGGAGG - Intronic
1172153926 20:32810519-32810541 AAGGCCAGGATTTTAGTTGGGGG - Intergenic
1172375392 20:34435071-34435093 AAACCCATGGTTTTACTACTAGG + Intronic
1174573402 20:51520249-51520271 CAAACCATGATTTTATTTAGTGG - Intronic
1174919149 20:54683302-54683324 TTACCCATGATTTTACTTTCAGG + Intergenic
1178215306 21:30590597-30590619 AGGCTCATGATTTTACTTGTTGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
951014066 3:17710309-17710331 AATCCCATCATTTTGGTTGGCGG + Intronic
951107844 3:18766515-18766537 AAACCTATCATTTTACTTTTTGG + Intergenic
954015739 3:47688887-47688909 GACCCCAAGATTTTACTTAGAGG - Intronic
954602182 3:51878328-51878350 GGACCCAGGAGTTTACTTGGTGG + Intergenic
954608089 3:51929178-51929200 GGACCCAGGAGTTTACTTGGTGG + Intergenic
955057155 3:55465064-55465086 AAAACCATGACTTTAGTTGGAGG - Intergenic
957562648 3:81842949-81842971 AAACTCATTATTTTACATGCTGG + Intergenic
958261373 3:91385116-91385138 AAACATAGGATTTTATTTGGGGG + Intergenic
960369638 3:116817894-116817916 AACCCTATGAGTTTTCTTGGTGG - Intronic
965333143 3:167402028-167402050 AGACCCAGGACTTTACTGGGTGG + Intergenic
967490524 3:190086049-190086071 AAACCCATTACTTTGCTTGATGG + Intronic
969269466 4:6089254-6089276 AATCCCATGACTTCAGTTGGGGG + Intronic
971166306 4:24187445-24187467 AAACCCATGATTTTCCTTTTAGG - Intergenic
971805605 4:31354860-31354882 TAATCCATGATTGTATTTGGAGG + Intergenic
972301639 4:37790637-37790659 AAAACCATTATTCTCCTTGGTGG - Intergenic
972934837 4:44120988-44121010 AAATGCATGATCTTACTTTGAGG + Intergenic
973089047 4:46109004-46109026 AAACCCTGGATCTTAGTTGGAGG + Intronic
975246482 4:72126703-72126725 ACACCCAGGGTTTTTCTTGGAGG - Intronic
976280644 4:83323645-83323667 AAAAGAATGATTTTCCTTGGTGG - Intronic
979029824 4:115629215-115629237 AAACCCATGATAATATTTGCTGG + Intergenic
983140253 4:164141606-164141628 GAGCCCATGATTTCACCTGGCGG + Intronic
984196405 4:176662896-176662918 ATAGCCATAATTTTATTTGGTGG + Intergenic
986393051 5:7302938-7302960 AAACCCATTCTTTTGGTTGGGGG + Intergenic
986887652 5:12259675-12259697 GAAGCCATGATTGTATTTGGGGG - Intergenic
988123050 5:26992551-26992573 TAACCAATTATTTTACTAGGTGG - Intronic
988374264 5:30413891-30413913 AAACCAATGATTTTTTTTGTTGG + Intergenic
988415127 5:30937355-30937377 AAATCCATGATTTTTCTTTCGGG + Intergenic
992027876 5:72688973-72688995 ATACACATGTTTTTCCTTGGGGG - Intergenic
995703036 5:114956871-114956893 TAATCCATGATATTATTTGGTGG + Intergenic
996761241 5:126987865-126987887 AAACCCATGATTTTACTTGGGGG + Intronic
996977431 5:129451759-129451781 AAACCCATGACTTGACTGGTTGG + Intergenic
1002917785 6:1542754-1542776 AGAACCCTGATTTTATTTGGGGG + Intergenic
1008154282 6:47994714-47994736 AAACCCATGGGTTTCCTTGGAGG + Intronic
1008258778 6:49339279-49339301 GAACACGTGGTTTTACTTGGTGG - Intergenic
1009182395 6:60534116-60534138 AAACATAGGATTTTATTTGGGGG - Intergenic
1011140789 6:84153863-84153885 AGGCCCATTATTTTACTTGTGGG - Intronic
1011854294 6:91669535-91669557 AAAGCCATGACTCTGCTTGGAGG - Intergenic
1014107049 6:117577513-117577535 AAACAAATGATTTTATTTAGTGG + Intronic
1014205211 6:118650472-118650494 AAACCCCTAATTTTCCTTGAAGG + Intronic
1019622187 7:1997947-1997969 AAAATCATGATTCTGCTTGGGGG + Intronic
1022400548 7:30032336-30032358 AATCCCATTATTTTAAATGGAGG - Intronic
1022495197 7:30848701-30848723 AAGCCCATCATGTTCCTTGGAGG - Intronic
1022887797 7:34664128-34664150 AAAAGCCTGAGTTTACTTGGGGG - Intronic
1026370606 7:69694773-69694795 AAATCCATTATTTTACAAGGTGG + Intronic
1028234594 7:88345719-88345741 GAAGCAATGATTTTATTTGGGGG + Intergenic
1030344450 7:108416624-108416646 AAACCCAAGTTTTTCCTTGGGGG - Intronic
1031696664 7:124864794-124864816 AAACCAATAATATTACATGGTGG - Intronic
1031741305 7:125434957-125434979 AAACGCATGATTTTAAAAGGTGG + Intergenic
1034758650 7:153649420-153649442 AAACGAATGAATTTACTTTGGGG + Intergenic
1036052142 8:5210368-5210390 ACTCCCAAAATTTTACTTGGAGG - Intergenic
1037715817 8:21398679-21398701 AAAGCCATAATTTTATTTGTAGG + Intergenic
1039855857 8:41413264-41413286 AAACCCAAAATTTTAGTGGGAGG - Intergenic
1043081852 8:75775919-75775941 AATCCCCTGTTTTTAATTGGGGG + Intergenic
1044550223 8:93504055-93504077 AAGCCCCTGATTTTACTAAGAGG + Intergenic
1046006379 8:108491087-108491109 AAACCCATAAATCAACTTGGGGG - Intergenic
1047070957 8:121342992-121343014 AGTCTCATGATTCTACTTGGTGG + Intergenic
1048210358 8:132449718-132449740 CAGTCCATGATTTTACTTTGGGG - Intronic
1048386348 8:133916206-133916228 AATCCCATGGAGTTACTTGGTGG - Intergenic
1051501586 9:17783775-17783797 AAACCCATGAATCTACTTCTAGG - Intronic
1052419480 9:28223878-28223900 AAACCCATTATCTTATTTTGGGG - Intronic
1059644023 9:116246300-116246322 AAACCCATTATTTTACCAGCTGG - Intronic
1061045343 9:128162061-128162083 AAACTCAGGATTGGACTTGGGGG - Intronic
1186383348 X:9084395-9084417 TAATCCATGACTTTACTAGGTGG - Intronic
1186561109 X:10614448-10614470 AAACACATGATTTTCCTTTCAGG - Intronic
1187052466 X:15708223-15708245 AAAGCCACGTTTTTACATGGTGG - Intronic
1188149560 X:26654557-26654579 GAACACATGATGTTATTTGGAGG + Intergenic
1188521153 X:31039467-31039489 CAACCTATAATTTTACTTTGAGG - Intergenic
1188694477 X:33173300-33173322 AAATTCATGATTTTAGTTGGAGG - Intronic
1189705907 X:43758525-43758547 AAAGCCATGATGCTACTTGCAGG - Intergenic
1190889218 X:54554396-54554418 AAACCCATGCTTTTAATTCTTGG + Intronic
1194438730 X:93902076-93902098 CAAGGCATGTTTTTACTTGGTGG - Intergenic
1195555325 X:106214880-106214902 AAATCCATGAATTGTCTTGGTGG + Intergenic
1196235104 X:113270632-113270654 AAAGCCATGCTTTTACTTTATGG + Intergenic
1198765687 X:140077302-140077324 AAACCCATTAGGTTACCTGGGGG + Intergenic