ID: 996763085

View in Genome Browser
Species Human (GRCh38)
Location 5:127005469-127005491
Sequence GGGACTTACCCAGGATCACG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 240
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 212}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996763085_996763094 13 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763094 5:127005505-127005527 GCATTCACATCCTCATCCAGGGG No data
996763085_996763095 14 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763095 5:127005506-127005528 CATTCACATCCTCATCCAGGGGG No data
996763085_996763088 -9 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763088 5:127005483-127005505 GTAAGTCCCACAACTCCTTAGGG 0: 1
1: 0
2: 0
3: 7
4: 121
996763085_996763087 -10 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763087 5:127005482-127005504 GGTAAGTCCCACAACTCCTTAGG 0: 1
1: 0
2: 2
3: 6
4: 112
996763085_996763093 12 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763093 5:127005504-127005526 GGCATTCACATCCTCATCCAGGG No data
996763085_996763092 11 Left 996763085 5:127005469-127005491 CCACGTGATCCTGGGTAAGTCCC 0: 1
1: 0
2: 1
3: 26
4: 212
Right 996763092 5:127005503-127005525 GGGCATTCACATCCTCATCCAGG 0: 1
1: 0
2: 1
3: 13
4: 138

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996763085 Original CRISPR GGGACTTACCCAGGATCACG TGG (reversed) Intronic
900288583 1:1914249-1914271 GGGACTTGTCCAGGGCCACGAGG + Intergenic
900596173 1:3481171-3481193 GGGACATACTCAGGATGCCGCGG + Intergenic
902434228 1:16386983-16387005 GGAACTTACCCAAGGTCACAAGG - Intronic
903143757 1:21356405-21356427 GGGACTTGCCCAAGACCACAGGG - Intergenic
903418938 1:23204503-23204525 GTGACTTGCCCAAGATCACATGG + Intergenic
903755105 1:25655176-25655198 AGGACTTTCCCAAGATCACACGG - Intronic
903858147 1:26349318-26349340 GTGACTGGCCCAGGATGACGCGG + Intronic
903954465 1:27015492-27015514 GGGACTTCCCCAAGGTCACGTGG - Intergenic
905311745 1:37053887-37053909 GTTACTTACCCAGAATCACATGG + Intergenic
906018007 1:42600180-42600202 GGAACTTATCCAGGATAAAGAGG + Intronic
906265495 1:44425625-44425647 GAGACTTACCCAGCATCACACGG - Intronic
906415950 1:45621629-45621651 GGGCCTCACCCAGGATCATAGGG + Exonic
906539485 1:46574242-46574264 GTGACTTGCCCAAGATCACATGG + Intronic
908255318 1:62298607-62298629 GTGACTTACCCAAGGTCACACGG - Intronic
909922427 1:81399187-81399209 AGAACTTACTCAGGATCATGAGG + Intronic
918232637 1:182550210-182550232 GGGACTTGCCTAGAATCACTTGG + Intronic
920718621 1:208366038-208366060 GTGACTTACCCAGGGCCATGTGG + Intergenic
920872640 1:209806627-209806649 GTAACTTACCCAGGGTCACACGG - Intergenic
924458147 1:244234522-244234544 GTGACCCACCCAGGATCAGGTGG - Intergenic
924623415 1:245681530-245681552 GGGACTTACACAGGGTCACGTGG + Intronic
924877075 1:248117165-248117187 GGTACTTACCCAAGAACATGGGG - Intergenic
1063386775 10:5620745-5620767 GGGAGCTACCCAGGGTCTCGGGG + Intergenic
1066506764 10:36053464-36053486 GTGACTTACCCAAGATCACATGG + Intergenic
1067288455 10:44924344-44924366 GGGACTCACCCAGGAGCTCTGGG - Intronic
1070772852 10:79092380-79092402 GTGACTGACCCAAGATCACATGG - Intronic
1072569918 10:96649612-96649634 GGAACATACCCAGGATTACTTGG - Intronic
1073435517 10:103513637-103513659 GGGACCTACCCAGACTCACAGGG + Intronic
1074235617 10:111581777-111581799 GGGAGTTTCCTAGGATCACTTGG - Intergenic
1074547554 10:114412998-114413020 GAGACTTACTCAGGATGATGTGG - Intergenic
1075116184 10:119628902-119628924 GGAACTTACCCAAGGTCACACGG - Intergenic
1075469879 10:122680134-122680156 GGGACTGACCAAGTATCCCGGGG - Intergenic
1077702913 11:4458240-4458262 GGTACTCACCCAAGATCATGGGG + Intergenic
1078561104 11:12373517-12373539 GAGATTTACCCAAGATCACCTGG + Intergenic
1080858504 11:36132898-36132920 GTCACTTGCCCAGGGTCACGTGG - Intronic
1081613394 11:44576861-44576883 GGGAGTTGCCCAGGATCCCGTGG + Intronic
1081784420 11:45736825-45736847 GTAACTTACCCAAGATCATGTGG - Intergenic
1083609383 11:63997929-63997951 GGGACTTGCCCAGGGTCCCAGGG + Exonic
1083741819 11:64715291-64715313 GGGACTTGCCCAAGGTCACACGG + Intronic
1085193612 11:74651272-74651294 ATGACTTTCCCAGGATCACATGG - Intronic
1085594097 11:77792213-77792235 GAGACTTACTCATTATCACGAGG + Intronic
1085692168 11:78672776-78672798 GGGATTTACCCTGGATCTCGTGG + Intronic
1085760831 11:79239868-79239890 GTGACTTACCCAAAGTCACGTGG - Intronic
1088415079 11:109579829-109579851 GGGACTTACTCAGAATTACAGGG - Intergenic
1091353233 11:134914374-134914396 GGGAGGGATCCAGGATCACGAGG - Intergenic
1091641824 12:2242951-2242973 GTGACTTACCCACGATCATAGGG + Intronic
1091950703 12:4590819-4590841 GTGACTTGCCCAGGAGCACATGG - Intronic
1092887611 12:12938697-12938719 GGGACTTGCCCAGTATAACATGG - Intergenic
1093224272 12:16462774-16462796 GTAACTTTCCCAAGATCACGTGG + Intronic
1095847457 12:46760715-46760737 AGGGCTTTCCCAGGATCACCTGG + Intergenic
1095881070 12:47136923-47136945 GGGAGTTACCCAAGGTTACGTGG - Intronic
1098954099 12:76670653-76670675 GGAACTTGCCCAAGATCACAGGG - Intergenic
1100764112 12:97844474-97844496 GTGACTTGCCCAGTATCACTTGG - Intergenic
1101925802 12:108970302-108970324 GCAACTTACCCAGGACCACATGG - Intronic
1102008035 12:109601215-109601237 GTGACTTGCCCAGGGTCACGTGG + Intergenic
1102024072 12:109703568-109703590 GGGACCTGCCCAAGGTCACGTGG + Intergenic
1102212920 12:111139922-111139944 GTGACTTACCCAAGGTCACACGG - Intronic
1102302616 12:111781719-111781741 GTGACTTACCCAAGGTCACTTGG + Intronic
1103165115 12:118763712-118763734 GAGACTTGCCCAGGGTCACATGG + Intergenic
1104350258 12:128039112-128039134 GGCTCTTTCCCAGGATCAGGAGG - Intergenic
1104876079 12:132035795-132035817 AGGACATACCCAGGTTCACGCGG + Intronic
1104990338 12:132620868-132620890 GGGACTGACCCGGGCTCTCGAGG + Intronic
1104990358 12:132620929-132620951 GGGACTGACCCGGGCTCTCGAGG + Intronic
1106153645 13:27131305-27131327 GTGACTCACCCAGAGTCACGTGG - Intronic
1106836082 13:33636492-33636514 GGGACTCTCCCAGGAACACTGGG + Intergenic
1107411357 13:40161573-40161595 GTAACTTACCCAGGGTCACATGG + Intergenic
1115884901 14:37960194-37960216 GGGTCTTGCCTAGGATCACATGG + Intronic
1121507710 14:94489451-94489473 GTGGTTTGCCCAGGATCACGGGG + Intronic
1122787962 14:104172655-104172677 GGTGCTTACCCAGGCTCATGTGG - Exonic
1123627674 15:22238850-22238872 GGGACTTGCTCAGGGCCACGTGG - Intergenic
1128099169 15:64984160-64984182 ATGACTTACCCAAGATCACATGG + Intronic
1128481704 15:68045677-68045699 GGGACTTTCCCAGGACCCCAAGG - Intergenic
1129508255 15:76101149-76101171 GTGACTTTCCCAGGATCACATGG + Intronic
1129687802 15:77696423-77696445 GGGACTTGCCCGGGGTCACCTGG - Intronic
1129799131 15:78400349-78400371 GAAACTCACCCAGGATCACATGG - Intergenic
1133296178 16:4753586-4753608 GAAACTTACCCAGAATCACCGGG + Intronic
1133730856 16:8577441-8577463 GGGACTTACCTAAGGTCACATGG - Intronic
1136789508 16:32957449-32957471 GGGATTTACCCAGGAATACAAGG + Intergenic
1136880304 16:33896481-33896503 GGGATTTACCCAGGAATACAAGG - Intergenic
1137727848 16:50669102-50669124 ATGACTTATCCAGGGTCACGTGG - Intronic
1137790637 16:51171870-51171892 GGGACTTGCTCAGGATCACATGG - Intergenic
1139399760 16:66671926-66671948 GAGACTTACAGAGGATCACTTGG + Intronic
1139429442 16:66903388-66903410 TTGACTTGCCCAAGATCACGAGG + Intergenic
1140822422 16:78675216-78675238 GTGACTCACTCAAGATCACGTGG + Intronic
1140995292 16:80253053-80253075 GAGACTTGCCCAAGATCACACGG - Intergenic
1141470223 16:84233234-84233256 GTGACTTTCCCAAGATCACTGGG + Intronic
1141984461 16:87570926-87570948 GGGACTTGCCCAAGGTCACTCGG - Intergenic
1203091708 16_KI270728v1_random:1218923-1218945 GGGATTTACCCAGGAATACAAGG + Intergenic
1142959726 17:3545080-3545102 GTGACTTGCCCTGGGTCACGGGG - Intronic
1142972747 17:3623787-3623809 GTGACTTGCCGAGGGTCACGGGG - Intronic
1142982905 17:3681642-3681664 GGGACTTGTCCAGAATCAGGCGG + Intronic
1143741897 17:8960646-8960668 TGGACTTAGCAAAGATCACGTGG + Intronic
1143772153 17:9175627-9175649 GGCACTAACCCAGGGTCACTGGG + Intronic
1144284109 17:13756014-13756036 GCGACTTACCCAAGACCAAGTGG - Intergenic
1146805737 17:35863783-35863805 GGGACTTGCCCAGGGCCAAGTGG - Intronic
1146894105 17:36528661-36528683 GTAACTTACCCAGGCTCACAGGG - Intronic
1147147377 17:38492921-38492943 GGGACTTCTCCAGGAGCACAGGG - Intronic
1147358039 17:39912722-39912744 GTGACTTACCCAAGGTCATGTGG - Intronic
1152461844 17:80445772-80445794 GGGACTTGCCCAGGGCCACCTGG - Intergenic
1154068699 18:11132794-11132816 GTGACTGACCCAGAATCACTGGG + Intronic
1155319147 18:24601793-24601815 GTGACTCACTCAGGATCACGTGG + Intergenic
1155958861 18:31977175-31977197 GGTACTTACCCAAGAACATGGGG - Intergenic
1159960523 18:74552044-74552066 GGGACTTAGCCAGGAGCCAGGGG - Intronic
1162135170 19:8550833-8550855 GGCACTTACCCAAGGTCACGCGG - Intronic
1163126132 19:15245204-15245226 GGGACTTGTCCAGGGTCACATGG + Intronic
1163174622 19:15555803-15555825 GTGACTTACCCAAGATCATTCGG + Intergenic
1163372435 19:16908899-16908921 GGGAGTTACCCCAGGTCACGCGG + Intronic
1166181785 19:41114027-41114049 GGGACTTAGCCAGGGCCACTCGG + Intergenic
1166432817 19:42741307-42741329 GGGAGTTACCCAGGAACCCCGGG + Intronic
1166831585 19:45642583-45642605 GGGACTTCCCCAAGGTCACACGG - Exonic
1167117862 19:47498492-47498514 CTGACTTGCCCAGGATCACAGGG + Intronic
1168160520 19:54507630-54507652 GGGCCTTGCTCAGGGTCACGTGG - Intronic
925080603 2:1061160-1061182 GCGTCCAACCCAGGATCACGCGG - Intronic
925975607 2:9139987-9140009 GTGACGTCCCCAGGATCACAGGG + Intergenic
926063581 2:9820158-9820180 AGGACTTGCCCAAGGTCACGCGG + Intergenic
926216860 2:10911404-10911426 GGGACTTGCCCAAGGTCACGCGG - Intergenic
926694898 2:15764337-15764359 GGGACTTCCCCAAGGTCACATGG + Intergenic
927071805 2:19538460-19538482 GGGACTTCCCCAGAATCATACGG - Intergenic
927197904 2:20560678-20560700 GGGACTCACCCAAGGTCACATGG + Intronic
928200391 2:29244235-29244257 GGGCCTTGCCCAGGATCCCACGG - Intronic
929089133 2:38197435-38197457 GGGACTTACTCAGAATCAATGGG + Intergenic
929670534 2:43873718-43873740 GTGACATTCCCAGGGTCACGGGG + Intronic
930237404 2:48901189-48901211 GGGATGTGCCCAGGGTCACGTGG + Intergenic
930769376 2:55116429-55116451 GAAACTTACCCAGGATCCCATGG - Intergenic
931193250 2:60025439-60025461 GGGAGTCACCCAGGATCCAGTGG - Intergenic
933815551 2:86065426-86065448 GGGACTGATCCAGGATCACATGG - Exonic
935177362 2:100661620-100661642 GGGGCTTCCACAGGATCACATGG + Intergenic
938290942 2:130150221-130150243 CTGACTTACCTTGGATCACGGGG + Intergenic
938366411 2:130737922-130737944 GAGACCTACCCAGGATCTCTCGG + Intergenic
938465604 2:131522733-131522755 CTGACTTACCTCGGATCACGGGG - Intergenic
942500139 2:176580583-176580605 GAGGCTCACCCAGGAACACGTGG + Intergenic
944469222 2:200035265-200035287 GGAACATATCCAGGATCACACGG + Intergenic
946096053 2:217274809-217274831 GGGGGTAACCCAGGATCATGGGG + Intergenic
948665829 2:239534266-239534288 GCGACTTCCCTGGGATCACGTGG - Intergenic
1168805178 20:668535-668557 GCGACTTACCCAAGGTCACATGG - Intronic
1168961727 20:1874630-1874652 GTGACTTGCCCAGCATCACATGG - Intergenic
1170083786 20:12506541-12506563 GTGACTTTACCAGGATCACAAGG - Intergenic
1170576945 20:17671429-17671451 TGGACTGACCCAGGAACACTAGG + Intronic
1170855154 20:20045767-20045789 GTGACTTATCCAAGATCACATGG - Intronic
1172902938 20:38348013-38348035 GGGAATTACCCAGGGACAAGGGG + Intronic
1173023009 20:39283713-39283735 TGGACTGACCCAGGATAACCAGG - Intergenic
1174391779 20:50222230-50222252 AGGTCTTTCCCAGGATCACAGGG + Intergenic
1174426611 20:50436094-50436116 GTAACTTACCCAGGGTCACCCGG - Intergenic
1174994544 20:55551170-55551192 GTGACTTACCCAAGGTCACGTGG - Intergenic
1175045131 20:56097778-56097800 GTGACTTACCCAAGGTCACACGG + Intergenic
1175458772 20:59135121-59135143 GGGACTCACACAAGATCACTGGG + Intergenic
1175536492 20:59718294-59718316 GAGACTGACCCTGGATCATGAGG + Intronic
1178332855 21:31714931-31714953 GGGAATTAACCAGGATCATCTGG - Intronic
1179326623 21:40352742-40352764 GTGAATTACCCAAGATCACATGG - Intronic
1179360785 21:40706256-40706278 CTGACTTGCCCAGGATCAGGCGG + Intronic
1179501529 21:41812377-41812399 GTGACATTCCCAGGATCAGGAGG + Intronic
1180144829 21:45913147-45913169 GGGACTCACCCAGGAGAAGGAGG + Intronic
1181762813 22:25069593-25069615 GGGACTTGGCCAAGGTCACGCGG - Intronic
1181936912 22:26445601-26445623 GGGACTTGCCCAAGGTCCCGAGG - Intronic
1182097996 22:27638824-27638846 GGGACTTGCCCAAGATCACAGGG + Intergenic
1182511036 22:30820580-30820602 GTGACTTGCCCAGGGTCACCAGG - Intronic
1183125921 22:35782017-35782039 GTGACTTGCCCAAGATCACATGG + Intronic
1183308327 22:37095897-37095919 AGTACTGACCCAGGATCACTAGG + Exonic
1183596129 22:38813051-38813073 GAGACTTCCCCAAGATCACATGG - Intergenic
1184449986 22:44577056-44577078 GGGACTTGCTCAGGGTCACACGG - Intergenic
949517706 3:4822075-4822097 GTGACTTGCCCAGGGTCACACGG - Intronic
950028373 3:9835649-9835671 ATGGCTTACCCAAGATCACGTGG + Intronic
950094685 3:10321998-10322020 GGGACTTACTCAGGACCCCAGGG - Intergenic
950145345 3:10645958-10645980 GGGTCCCACCCAGGATCAAGTGG - Intronic
954423057 3:50428745-50428767 GGGACTTGCCCAAGGTCACTAGG + Intronic
960645404 3:119875579-119875601 GTGACTTACCCAAGATTACATGG - Intronic
962668842 3:137684521-137684543 AAGACTTGCCCAGGATCACTTGG + Intergenic
962715618 3:138123604-138123626 GAGACTGTCCCAGGATCATGAGG + Intergenic
963528659 3:146446753-146446775 TGGACCTACCCAGGACCATGAGG - Intronic
966929450 3:184666316-184666338 GTGACTTACCCAAGTTCACAAGG - Intronic
967976830 3:195040224-195040246 GTGACTTGCCCAAGGTCACGCGG + Intergenic
968045279 3:195620481-195620503 GGGACTTGCCCAAGGTCACTCGG - Intergenic
968061134 3:195726824-195726846 GGGACTTGCCCAAGGTCACTCGG - Intronic
968929479 4:3570974-3570996 GGGACTTACGCAGGAGCAGCTGG + Intergenic
969053835 4:4389505-4389527 GGGACATACCCAAGGTCACTGGG + Intronic
969153120 4:5187141-5187163 GGGGTTTACCCAGGGTCACGTGG + Intronic
971361683 4:25943875-25943897 GGGACTTACCCAAGATCCCATGG - Intergenic
971431308 4:26570808-26570830 GTGACTTACCATGGATCACATGG - Intergenic
973607553 4:52602571-52602593 GTGACTTGCCCAAGATCACAAGG - Intronic
977705612 4:100067008-100067030 TGGATTTGCCCAAGATCACGTGG - Intergenic
982766357 4:159353559-159353581 GGAACTTTCCCAGGATCAGGGGG + Exonic
984969434 4:185174055-185174077 GGGACTTACTCAAGGTCACACGG - Intronic
985536714 5:469184-469206 GGGAATTACCCAGGATGAGCAGG + Intronic
989532136 5:42520336-42520358 GGGATTTACACAAGATCACAAGG - Intronic
996763085 5:127005469-127005491 GGGACTTACCCAGGATCACGTGG - Intronic
997668115 5:135648576-135648598 GGGACCTGCCCAGGCTCACATGG - Intergenic
999515144 5:152294492-152294514 GGGACTCACCCAGGGTCACATGG + Intergenic
999730103 5:154470559-154470581 GGGACTTGCCCAGCATCTCAGGG - Intergenic
1000310038 5:160033741-160033763 GGGACGGACCCTGGATCATGGGG - Intronic
1001837892 5:174847420-174847442 GGCACTTACTCAAGGTCACGGGG + Intergenic
1001923371 5:175617839-175617861 GGGACTTATCTAGAGTCACGTGG + Intergenic
1002839080 6:890350-890372 GGAACTGACCCAGGGTCACATGG - Intergenic
1002906609 6:1454207-1454229 TGGACTTTCCCAGGATGACCAGG - Intergenic
1004087989 6:12470849-12470871 GGGATTTGCTCAGGATCACTCGG - Intergenic
1005986406 6:30878468-30878490 GGGACGTACACAGGATAAAGTGG + Intronic
1006876486 6:37301902-37301924 GAGACCTACCCAGGATAATGAGG - Intronic
1007374789 6:41449172-41449194 GGGACTTGTCCAGTATCACATGG + Intergenic
1014153321 6:118084096-118084118 GTGACTTGCCCAGGGTCACATGG + Intronic
1017780401 6:157711205-157711227 GTGACTTACCCAAGGTCACGTGG - Intronic
1021640104 7:22728233-22728255 GGAATTTACCCAAGATCACAAGG - Intronic
1027352735 7:77328056-77328078 GTGACTTGCCCAGGAGCACATGG + Intronic
1030371376 7:108703197-108703219 ATGACTTTCCCAGGATCACACGG + Intergenic
1035071355 7:156147474-156147496 GTGACTTACCCAAGACCAGGAGG - Intergenic
1035274451 7:157739152-157739174 GGGACTCACCCAAGGTCACACGG + Intronic
1035520241 8:270493-270515 GGGACTTACCCAGACTCACAGGG + Intergenic
1035696943 8:1605171-1605193 GTGACTTACCCAGGTTCATACGG + Intronic
1037758848 8:21728718-21728740 GGGACTTGCCCAAGGTCACATGG - Intronic
1039848171 8:41341020-41341042 GGGACTTGGCCACGATCATGTGG - Intergenic
1042394090 8:68270930-68270952 GTGACTTTCCCAAAATCACGTGG - Intergenic
1046540585 8:115576533-115576555 GTGACTCACCCAGGGTCACACGG + Intronic
1047034028 8:120914824-120914846 GTGACTTTCCCAGGATCATATGG + Intergenic
1047494448 8:125399554-125399576 GGGACCTGCCCAGGGTCACACGG - Intergenic
1048155310 8:131942467-131942489 GGGACTTGCCCAAGATCATCTGG - Intronic
1049355912 8:142187945-142187967 GGGACTTAGGCAGGCTCACCTGG - Intergenic
1053428351 9:38025778-38025800 GGGTCTTGCCCAGGGTCACCTGG + Intronic
1053804171 9:41784410-41784432 GGGACTTACGCAGGAGCAGCTGG + Intergenic
1054141108 9:61531049-61531071 GGGACTTACGCAGGAGCAGCTGG - Intergenic
1054192479 9:61995906-61995928 GGGACTTACGCAGGAGCAGCTGG + Intergenic
1054645927 9:67592785-67592807 GGGACTTACGCAGGAGCAGCTGG - Intergenic
1056438826 9:86599551-86599573 GTAACTTACCCAGGGTCACATGG + Intergenic
1057329520 9:94100192-94100214 GTGACTTGCTCAGGGTCACGTGG + Intronic
1059659389 9:116386547-116386569 GGGACTTGCCCAAGTTCACTTGG + Intronic
1060519970 9:124288752-124288774 GGGACTGGCCCAGGCTCACATGG + Intronic
1060702504 9:125769772-125769794 AGGACTTACCCAGGAACCCCAGG - Intronic
1060987107 9:127826028-127826050 GGGACTTGCACAGGGTCACTTGG - Intronic
1061005932 9:127928432-127928454 GGTCCTAACCCAGGTTCACGAGG - Exonic
1061209000 9:129179946-129179968 GAGACTTGCCCAAGATCACATGG + Intergenic
1061234849 9:129336440-129336462 GGGACTAACCCAAGATCACTGGG - Intergenic
1061498594 9:130989839-130989861 GGGACTTACCGAGGGTCCCAGGG - Intergenic
1061710949 9:132487245-132487267 GGGACTTACCCAAGGTCACACGG + Intronic
1061787154 9:133036519-133036541 GGTACTTACTCAAGAACACGGGG - Intronic
1188443791 X:30235981-30236003 GGGTCAGACCCAGGATCACCAGG + Exonic
1193038228 X:76976802-76976824 GTGACTTGCCCAAGATCACATGG + Intergenic
1196864898 X:120061824-120061846 GGGACTCACTCACTATCACGAGG - Intergenic
1196878203 X:120174508-120174530 GGGACTCACTCACTATCACGAGG + Intergenic
1197043585 X:121969956-121969978 GGGACTGACCCAGCACCACTGGG - Intergenic
1199606062 X:149580496-149580518 GGGTATTTCCCAGGATCAGGTGG - Intergenic
1199633059 X:149788872-149788894 GGGTATTTCCCAGGATCAGGTGG + Intergenic
1199893696 X:152112878-152112900 GGGTATTTCCCAGGATCACGTGG - Intergenic
1199950678 X:152703505-152703527 GGGTATTTCCCAGGATCACGTGG + Intergenic
1199959004 X:152764956-152764978 GGGTATTTCCCAGGATCACGTGG - Intergenic