ID: 996765453

View in Genome Browser
Species Human (GRCh38)
Location 5:127030734-127030756
Sequence CTGGCGGGACGCGCCGGCGG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 231
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 206}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996765437_996765453 16 Left 996765437 5:127030695-127030717 CCCGTAACCGCCGTCCAGTCGCC 0: 1
1: 0
2: 0
3: 2
4: 10
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765436_996765453 17 Left 996765436 5:127030694-127030716 CCCCGTAACCGCCGTCCAGTCGC 0: 1
1: 0
2: 0
3: 0
4: 5
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765447_996765453 -5 Left 996765447 5:127030716-127030738 CCTGCGGCCGAGGGCAGGCTGGC 0: 1
1: 0
2: 3
3: 12
4: 241
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765441_996765453 6 Left 996765441 5:127030705-127030727 CCGTCCAGTCGCCTGCGGCCGAG 0: 1
1: 0
2: 0
3: 2
4: 45
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765438_996765453 15 Left 996765438 5:127030696-127030718 CCGTAACCGCCGTCCAGTCGCCT 0: 1
1: 0
2: 0
3: 2
4: 24
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765444_996765453 2 Left 996765444 5:127030709-127030731 CCAGTCGCCTGCGGCCGAGGGCA 0: 1
1: 0
2: 2
3: 5
4: 66
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765435_996765453 20 Left 996765435 5:127030691-127030713 CCGCCCCGTAACCGCCGTCCAGT 0: 1
1: 0
2: 0
3: 4
4: 26
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206
996765440_996765453 9 Left 996765440 5:127030702-127030724 CCGCCGTCCAGTCGCCTGCGGCC 0: 1
1: 0
2: 0
3: 9
4: 94
Right 996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG 0: 1
1: 1
2: 1
3: 22
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996765453 Original CRISPR CTGGCGGGACGCGCCGGCGG CGG Exonic
900180240 1:1308040-1308062 CGGGCGGCGCGCGCGGGCGGCGG - Intronic
900244274 1:1630319-1630341 CTGGCGCGGCGGGCCGGGGGCGG - Exonic
900495321 1:2973474-2973496 TTGGCGGGACGCCCCGGCCCAGG + Intergenic
901845582 1:11980215-11980237 CGCTTGGGACGCGCCGGCGGAGG + Intronic
903132733 1:21290240-21290262 GGGGCGGGGCGCGGCGGCGGCGG - Intronic
904006649 1:27366528-27366550 CTGGCAGGACCCGCTGGCCGTGG - Exonic
905037906 1:34929564-34929586 CTGAGGGGCCGCGCCGGCTGCGG + Exonic
905212779 1:36385871-36385893 ATGGAGGGAGGCGGCGGCGGCGG - Exonic
905616982 1:39408500-39408522 CCGGCAGGTCGCGCCGGCTGGGG - Intronic
905779112 1:40692100-40692122 TTGGCGGAAGGCGACGGCGGGGG + Intronic
906319724 1:44808536-44808558 CTGGCTGGCGGCGGCGGCGGCGG - Exonic
906403400 1:45521992-45522014 CCGGCGGGGCGCGCCGGGCGGGG - Intronic
907341547 1:53739191-53739213 CCCGCAGGACGCGGCGGCGGCGG - Intergenic
909622500 1:77683477-77683499 CTGGCGGGCGGCGGCGGCGGCGG + Intergenic
910569598 1:88684644-88684666 CTGGTGAGAGGCGCTGGCGGAGG + Intronic
915722103 1:157993264-157993286 GTGGAGGGAGGCGCCGTCGGAGG + Intronic
916390037 1:164321393-164321415 CCGGCGGGCCCCGCCGGCTGCGG - Intergenic
919362105 1:196608822-196608844 CTGGCGGGAATCGGGGGCGGTGG + Exonic
920002288 1:202808088-202808110 CTGGCGTGACTCACCGGCGGCGG + Exonic
920352052 1:205343885-205343907 CTGGGAAGACGCGGCGGCGGAGG + Intronic
921127505 1:212190386-212190408 CTGGCGGGAGGCGCGGGCCAGGG - Intergenic
922526740 1:226309539-226309561 CGGGAGGGAGGCCCCGGCGGGGG + Exonic
923008002 1:230067371-230067393 CTGGCCGGGGGCGCGGGCGGCGG + Exonic
923163750 1:231339582-231339604 ATCGCGGGAGGCGCCCGCGGGGG + Intronic
1062834207 10:625245-625267 CTGACGGGAAGCGGCGGGGGAGG - Intronic
1066022862 10:31319887-31319909 CAGGCGGGCTGCGGCGGCGGCGG + Intronic
1066080780 10:31928782-31928804 CTGCGGGGACGGGCCGGCCGCGG - Exonic
1069738389 10:70672448-70672470 GCGGCGGGACGGGCCGGGGGTGG - Intergenic
1070610168 10:77927095-77927117 GAGGAGGGACGGGCCGGCGGCGG - Intergenic
1072162945 10:92785180-92785202 CTGGCGGGAAGCTCCGAGGGAGG + Intergenic
1072915542 10:99535512-99535534 CCGGCGGGCGGCGGCGGCGGCGG + Exonic
1074618592 10:115093820-115093842 CCGGCGGGCGGCGGCGGCGGGGG + Exonic
1076722035 10:132397012-132397034 CTCCCGGGACGCGGCGGCGGCGG + Intergenic
1076792880 10:132786106-132786128 CGGGCGGGCGGCGGCGGCGGCGG + Intergenic
1079308562 11:19345348-19345370 CTGGCTGGACTGCCCGGCGGCGG + Intergenic
1083335051 11:61917400-61917422 CTGGGAGGACGCGGCGGCGCTGG - Exonic
1084174313 11:67415696-67415718 CGGGCGGGATGCAGCGGCGGCGG - Intronic
1091225744 11:133955905-133955927 CTGGCTGGGGGCGGCGGCGGGGG - Intronic
1091740830 12:2959459-2959481 CTGGCGGGACGCGGCGGCGCCGG - Exonic
1091866175 12:3839154-3839176 CAGGCGGCAGGCGGCGGCGGCGG - Intronic
1094564874 12:31590632-31590654 CTGTGGGGACGCGCGGGAGGCGG - Intronic
1096668218 12:53181010-53181032 GCGGCGGGACGCGCGGGCAGGGG - Intronic
1096700582 12:53380392-53380414 CGGGCGGGAGGCGGCGGCGGCGG + Intronic
1096863833 12:54549596-54549618 CTGGCAGCGCGCGGCGGCGGCGG + Exonic
1097251075 12:57632614-57632636 CTGGCGGGCGCCCCCGGCGGAGG + Intronic
1098161156 12:67649041-67649063 CGGCCGGGAGGCGGCGGCGGCGG + Exonic
1101150220 12:101877201-101877223 CTGCTGCGAAGCGCCGGCGGCGG + Intergenic
1101640132 12:106581637-106581659 CCGGCGGGCCGCGGCGGGGGCGG - Intronic
1101910612 12:108857820-108857842 ATAGCGGGGCGCGCGGGCGGGGG - Intergenic
1102884066 12:116508484-116508506 CAGGCGGGACGCGGCGTCGGGGG + Intergenic
1103407455 12:120686353-120686375 CTGGCGGGAGTCGCCGCCGGCGG - Intergenic
1104980283 12:132570489-132570511 CTGGCCGGCAGCGCCGGGGGCGG - Exonic
1106269487 13:28139105-28139127 GGGGCGGGCCGCGGCGGCGGAGG + Intronic
1107851497 13:44576825-44576847 CGGCCGGGGCGCGGCGGCGGCGG + Intronic
1108643844 13:52407620-52407642 CAGGCTGCACGCGCCGGCAGTGG - Intergenic
1112449846 13:99498651-99498673 CTGGTGGGAGGGGCCGGGGGCGG - Intergenic
1114037906 14:18646470-18646492 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1118621668 14:67619819-67619841 CTGGTTGGAGGCGCGGGCGGCGG + Exonic
1120167900 14:81220346-81220368 GAGGCGGGAAGCGGCGGCGGCGG + Intronic
1122917589 14:104865982-104866004 CGGGCGGGGCAGGCCGGCGGTGG - Intronic
1123719830 15:23050189-23050211 CTGGCCGGAGGTGCCGGGGGGGG + Intergenic
1124500347 15:30223034-30223056 TTGGGGGGGCGCGGCGGCGGCGG - Intergenic
1124612162 15:31216049-31216071 CGGGCGGGGCGCGCGGGAGGCGG + Intergenic
1124743226 15:32315632-32315654 TTGGGGGGGCGCGGCGGCGGCGG + Intergenic
1126738156 15:51751925-51751947 CGGGCGGGAGGCGCCCGCCGGGG + Intronic
1128374788 15:67066732-67066754 GGGGCGGGAGGCGGCGGCGGAGG - Intronic
1130370802 15:83284336-83284358 CGGCCGGGAGGCGGCGGCGGGGG - Intronic
1132527784 16:426072-426094 CGGGCCGGACGGGCCGGGGGCGG + Exonic
1132994795 16:2817350-2817372 CTGGCGGGATGGGGAGGCGGGGG + Intronic
1133232138 16:4371914-4371936 CTGGCGGGTCGGGCCCGAGGGGG - Exonic
1133784564 16:8964034-8964056 CAGGCGGGCCTCGGCGGCGGCGG - Intronic
1134614869 16:15643222-15643244 CGGACAGGACGCGGCGGCGGAGG - Intergenic
1135577418 16:23596377-23596399 CTGTCGGGCACCGCCGGCGGTGG + Intergenic
1138450775 16:57092569-57092591 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
1139390803 16:66605364-66605386 CTGCGGGGCCGAGCCGGCGGGGG + Intronic
1139402942 16:66696654-66696676 CGGGCGAGAGGCGGCGGCGGCGG - Exonic
1139433851 16:66925273-66925295 CAGGCGGGATGCTCCGGCCGAGG + Intronic
1139633722 16:68245587-68245609 CGGGCGGGACGGGCCGCGGGCGG + Intronic
1140223242 16:73058661-73058683 CTGGCGGGGGTCGGCGGCGGCGG + Intronic
1141972430 16:87492711-87492733 CTGGGCGGAGGCGCGGGCGGCGG - Intergenic
1142005984 16:87689822-87689844 CTGGCGGCGGGCGCGGGCGGCGG - Exonic
1142752769 17:1998428-1998450 CTCGCGGGAGCCGCCGGCCGGGG + Intronic
1143389827 17:6553741-6553763 CTGGCGGGGTGGGGCGGCGGGGG - Intronic
1147400406 17:40177509-40177531 CTGAGAGGACGCGGCGGCGGCGG - Intronic
1147400524 17:40177919-40177941 GTGGCGGGAGGTCCCGGCGGGGG + Intronic
1147648804 17:42050476-42050498 CGGGCGGGACGGGCGGGCGGAGG - Intronic
1148685382 17:49497695-49497717 CTGGCGGGCCGCGCCGGTAATGG + Intronic
1150675814 17:67245277-67245299 CGGGCGGGAGGCGCGGCCGGAGG - Intronic
1152197380 17:78925500-78925522 CTGGGGGGAGGCGCGGGCGGAGG - Intergenic
1152517851 17:80836702-80836724 CTGGAGGGAGGTGCCGGCAGAGG + Intronic
1153688207 18:7567245-7567267 CTAGCGGGCCGCGGCGGCGCCGG + Exonic
1154367671 18:13726346-13726368 GCGGCGGGAAGCGGCGGCGGCGG - Exonic
1156171689 18:34493798-34493820 CGGGCGGAGAGCGCCGGCGGGGG + Intronic
1156698819 18:39799340-39799362 CGGGCGGGAGGGGGCGGCGGCGG + Intergenic
1157706799 18:49813960-49813982 TGGGCGGGGCGCGGCGGCGGCGG + Exonic
1158150159 18:54358305-54358327 GTCGCGGGACGCGGCGGAGGGGG + Intronic
1160163263 18:76491390-76491412 CGGGCGGGGGGAGCCGGCGGGGG - Intronic
1160730340 19:639174-639196 CTGGCGGGGCACGTCGGAGGCGG - Intergenic
1160790358 19:920158-920180 GTGGTGGGAGGCGCCGGTGGGGG + Intronic
1161156120 19:2732663-2732685 CTTGGGGGACGCGCGGCCGGGGG + Exonic
1161227842 19:3155493-3155515 CTGGCTGGGCGACCCGGCGGAGG - Intronic
1162027705 19:7903911-7903933 CGGGCGGTGCGCGGCGGCGGTGG + Exonic
1162481437 19:10929054-10929076 CTGCAGGGACGCTTCGGCGGAGG + Exonic
1162959624 19:14118096-14118118 CCGGCGGGGCGGGGCGGCGGAGG + Intergenic
1163320462 19:16571846-16571868 CCGGCGGGACGCGCCCCGGGCGG + Intronic
1163663003 19:18589572-18589594 CTCGCGGGAGGTGCTGGCGGTGG + Exonic
1163793365 19:19321191-19321213 CTGACGGGTCGCGACCGCGGCGG + Intronic
1165172898 19:33906241-33906263 CTGGCGGGCCGCGCAGGGCGGGG - Intergenic
1165243050 19:34482251-34482273 CTGGCGGGGTCCGACGGCGGCGG + Exonic
1166975112 19:46601290-46601312 GGGGCGGGAGGCGGCGGCGGCGG + Exonic
1166983887 19:46648741-46648763 CCTGCGGGAGGCGTCGGCGGGGG - Exonic
1167258291 19:48443654-48443676 GTGGTGGGGCGCGGCGGCGGCGG - Exonic
1168076322 19:53982535-53982557 CTGGCGGGGGCCGGCGGCGGCGG + Exonic
926095595 2:10079571-10079593 CTGGAGCGGGGCGCCGGCGGTGG - Intronic
926130963 2:10302903-10302925 CAGGCGGGCCGCGGCGGCGGCGG + Intronic
927472317 2:23385557-23385579 CTGCCGGGAGGCGGCGGCGGCGG + Exonic
927945780 2:27134407-27134429 CGGGCGGGATGGGCCGGCGCCGG - Exonic
929188742 2:39120822-39120844 GTGGAGGGACGCTCCGGCCGCGG + Intronic
930700875 2:54456856-54456878 CTGCAGGGAGGCGCCGGCGGAGG - Intronic
932765311 2:74465384-74465406 CCGGCGGGAGGCGGAGGCGGAGG - Exonic
932812023 2:74833936-74833958 CTGGGGAGGCGCGCCGGGGGCGG - Intergenic
942046517 2:172102300-172102322 CCGGCGGGCGGCGGCGGCGGCGG - Exonic
942278055 2:174336804-174336826 CAGGTGGGAGGCGGCGGCGGCGG - Exonic
944070008 2:195657621-195657643 CTCGCGGGCCGCGCCCGGGGTGG + Intronic
944221757 2:197310535-197310557 CGGGCGGGACGCGCGGGCGCGGG - Intronic
944675848 2:202033873-202033895 CCGGCGGGCGGCGGCGGCGGCGG + Intergenic
945673703 2:212831866-212831888 CTAGCGGGGCGCTCCCGCGGGGG + Intergenic
946242987 2:218368015-218368037 CGGGCGGGACGCGCCGGGGCGGG + Exonic
948492137 2:238320550-238320572 CTGGCAGGACCGGGCGGCGGCGG + Exonic
948828687 2:240586812-240586834 CGGGCGGGGCGGGCCGGAGGCGG + Exonic
1170684175 20:18554028-18554050 CTGGGGGAATGCGCAGGCGGGGG + Intronic
1173454157 20:43189990-43190012 CGGGCGGGCGGCGGCGGCGGCGG - Intergenic
1173909170 20:46651434-46651456 CTGGCGGTACGGGCCGGCCCGGG + Exonic
1176156927 20:63626760-63626782 CAGGCGGGCGGCGCGGGCGGTGG - Intronic
1176194332 20:63830619-63830641 CCGGCGGGGGGCGCGGGCGGGGG + Intronic
1180085488 21:45506281-45506303 CTGACGGGACGAGGCGGCAGGGG + Intronic
1180264214 21:46699281-46699303 GAGGCGCGGCGCGCCGGCGGAGG - Intergenic
1180462033 22:15573512-15573534 CTTTCGGGAGGCGGCGGCGGCGG - Intergenic
1183517113 22:38272979-38273001 GGCCCGGGACGCGCCGGCGGCGG - Exonic
1184207599 22:43014951-43014973 CGGGCGGGACGCGGGGGCGCTGG - Intronic
1185055262 22:48575860-48575882 CTGGCCCGCCGCGGCGGCGGTGG + Intronic
1185333547 22:50261858-50261880 CTGGGGGGAAGCGCAGGGGGAGG + Intergenic
1185336338 22:50272270-50272292 CTGGAGGGAGCCGCCGGTGGAGG + Intergenic
1185394077 22:50578055-50578077 CTGGCGGGGGGCGCGGGCCGGGG - Intronic
953031251 3:39181158-39181180 CCGGTGGTGCGCGCCGGCGGCGG - Intergenic
953099228 3:39809397-39809419 CGGGCGGCACGCGCCGGGAGGGG - Intronic
953614419 3:44477559-44477581 CTGGCGGGGCGCGGGGGTGGGGG - Intronic
960577084 3:119240629-119240651 CTGGCGGGAGGCACCGGCTCAGG - Exonic
961665862 3:128492834-128492856 CAGGCGGGCCGGGCCGGGGGCGG + Intronic
963289934 3:143477355-143477377 GTGGCGGGAGGGGGCGGCGGGGG - Intronic
963605665 3:147410156-147410178 GTGGCGGGACGCGCCAAAGGTGG - Exonic
967055346 3:185825113-185825135 CGGGCGGGCCGGGCCGGCCGCGG - Intergenic
967930675 3:194688037-194688059 CTGGCGGGACGAGTCCCCGGCGG - Exonic
968230673 3:197003119-197003141 CGCGCGGGCCGCGCCGGAGGAGG - Exonic
970399404 4:15703224-15703246 CGGGCGGGGCGCGCGCGCGGTGG + Exonic
971018948 4:22515684-22515706 CTGCTGGGAGGCGGCGGCGGCGG - Exonic
971230843 4:24799484-24799506 CCTGCGGGACGCCCCCGCGGAGG - Exonic
972173449 4:36375372-36375394 CTGGCGGGAAGCTCCGCCTGCGG + Intergenic
972533050 4:39977566-39977588 CGGGCGGGCGGCGGCGGCGGCGG - Exonic
972793862 4:42397799-42397821 CCTGCGGGAGGCGCCGGCAGAGG - Intergenic
982745809 4:159103385-159103407 ATGGGGGGAGGCGGCGGCGGCGG + Intergenic
984668011 4:182448860-182448882 CTGGCGGGAGGCGGCGGTGGCGG + Intronic
986748159 5:10761617-10761639 CTGCCGGGACGCCCCGGCCCTGG - Intergenic
988796214 5:34656067-34656089 CAGCCGGGACGCGCGGGCCGGGG + Intergenic
991676555 5:69094283-69094305 CTGGCCGGCCCCGGCGGCGGCGG + Exonic
993901216 5:93585105-93585127 CAGGCGGCCCGCGGCGGCGGCGG + Exonic
996765453 5:127030734-127030756 CTGGCGGGACGCGCCGGCGGCGG + Exonic
998083182 5:139293695-139293717 CTGGCGAGAAGCGGCGGCAGCGG - Intronic
999300237 5:150486226-150486248 CGGGCGGGAGGAGGCGGCGGCGG + Intronic
999327251 5:150650920-150650942 CTGGAGGGGAGCGCAGGCGGAGG - Exonic
1004690339 6:17987674-17987696 GGGGCGGGGCGCGGCGGCGGCGG + Intergenic
1005040334 6:21595141-21595163 GTGGCGGGCGGCGCGGGCGGTGG + Exonic
1005040346 6:21595192-21595214 CTGGCAGGCGGCGGCGGCGGCGG + Exonic
1005728703 6:28674603-28674625 CTGGCCAGGCGCTCCGGCGGCGG + Intergenic
1006366906 6:33621361-33621383 CGGGCGGGGCGGGCGGGCGGCGG + Exonic
1006665162 6:35688490-35688512 CTGCCGGGAGAGGCCGGCGGGGG + Intronic
1007432799 6:41786417-41786439 CTGGAGGGACGGGACGGCGTGGG - Intronic
1007633491 6:43285223-43285245 CCGGCGGGACGCCCCGGGGCGGG - Exonic
1007784089 6:44270532-44270554 CTGGGGGGCCGGGCCGGGGGGGG - Exonic
1012399930 6:98834671-98834693 CGGGCGGGAGGCGGCGGCGGCGG + Exonic
1012887262 6:104859880-104859902 CGGGAGGGACGCGGCGGCGGGGG - Exonic
1015149099 6:130019294-130019316 GAGGCGGGGGGCGCCGGCGGGGG + Intronic
1015149264 6:130019968-130019990 GTGTCGGGAGGCGGCGGCGGCGG + Intronic
1017470504 6:154733634-154733656 CTGCCGGGGCGGGTCGGCGGCGG - Intronic
1017708641 6:157147353-157147375 CTGGCGGGCAGGGCCGGAGGCGG - Intronic
1017708828 6:157147833-157147855 CTGGCGGGCAGGGCCGGAGGCGG - Intronic
1019473278 7:1232534-1232556 CTGGCGGGAGGCGCGGGCTCGGG + Intergenic
1019473379 7:1232928-1232950 GCGGCGGGAGGCGCGGGCGGCGG - Exonic
1019711823 7:2521328-2521350 CTGGCGGGAGGGGGCGGCGGGGG + Intronic
1020204612 7:6105123-6105145 CCGGCGGGCCGCGCCGGCTGAGG - Intronic
1022427667 7:30284553-30284575 CTGGCGGCACGAGGGGGCGGGGG + Exonic
1024317473 7:48035299-48035321 CGGGCGGGACGCAGCGGGGGTGG - Intergenic
1025149533 7:56537957-56537979 CTGGAGGGACGCGGAGGAGGAGG + Intergenic
1027232615 7:76281571-76281593 CGGGCGGGGCGGGCAGGCGGCGG + Exonic
1027232958 7:76282661-76282683 CTGGCGGGCCGCGCGCGCGGGGG - Exonic
1027540080 7:79454487-79454509 CTGGCGGGACGCGCGGGCGGGGG - Intergenic
1028762351 7:94509947-94509969 CCGGCGGGAGGCGCAGGTGGCGG + Exonic
1029439047 7:100577370-100577392 CAGGCGGGAGGAGCCGGCAGGGG - Exonic
1030138703 7:106284572-106284594 CTGGGGGCGCGCGGCGGCGGCGG - Intronic
1032098769 7:128955272-128955294 CTGGCGGGACACCCTGGTGGCGG + Exonic
1032151692 7:129434645-129434667 CCGGCGGGAAGCGGCGGCTGAGG + Intronic
1032344385 7:131106034-131106056 CTGCCGGGGCGCGCGGCCGGCGG - Intergenic
1033339197 7:140478987-140479009 CTGGGGGAACGCGGCGGCAGCGG + Intronic
1034414639 7:150958064-150958086 CTGGCGTGGCGCGGTGGCGGGGG + Exonic
1037841027 8:22245340-22245362 CTGGAGGGACGCACCGACTGGGG + Exonic
1038450027 8:27633917-27633939 CCAGCGGGAAGCGCGGGCGGCGG + Intronic
1039454608 8:37698430-37698452 ATGGCAGGAGGCGGCGGCGGCGG - Exonic
1041713005 8:60910265-60910287 CTGGAGGGACGCGCCAGCTGCGG - Intergenic
1043428453 8:80171539-80171561 TTCGCGGGAGTCGCCGGCGGAGG - Intronic
1044115252 8:88327522-88327544 CGGGCTGGAGGCGGCGGCGGCGG - Intronic
1046770367 8:118111689-118111711 CCGGCTGGAGGCGGCGGCGGCGG + Exonic
1047381876 8:124372074-124372096 CGGGCGGGGCGCGGCGGCGGCGG + Exonic
1049668388 8:143858950-143858972 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049668804 8:143860549-143860571 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669219 8:143862151-143862173 CTGGCGGCGGGCGGCGGCGGTGG + Exonic
1049669634 8:143863753-143863775 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049670044 8:143865346-143865368 CTGGCGGCGGGCGGCGGCGGCGG + Exonic
1049746964 8:144267094-144267116 CGGGCGGGAGGCGGCGGGGGCGG - Exonic
1054781938 9:69174014-69174036 GGGGCGGGAGGCGGCGGCGGCGG - Intronic
1055722714 9:79193745-79193767 CCGGCGGGAGGCGCCGGAGCGGG + Intergenic
1057054542 9:91950307-91950329 CCGGGGGAACGCGCGGGCGGCGG + Intergenic
1057076578 9:92141332-92141354 CCGGCGGGCTGCGCCGTCGGTGG - Intergenic
1057631134 9:96719929-96719951 CTGGCGGGACTCCCCAGCGCTGG + Intergenic
1058110799 9:101029178-101029200 CTGGCCGGACCCGGCGGCGCAGG + Intronic
1060215529 9:121736401-121736423 CGGGCGGGACGCGCAGGCCCTGG - Intronic
1061144122 9:128787271-128787293 CTGGGGGGCGGCGGCGGCGGCGG + Exonic
1061501927 9:131009086-131009108 CTGGAGGGAGGGGCGGGCGGCGG - Exonic
1062272110 9:135714408-135714430 CTGGCGGCACATGCGGGCGGGGG - Intronic
1062653529 9:137590425-137590447 CGGGCGCGAGGCGGCGGCGGAGG - Exonic
1197776329 X:130120879-130120901 CACGCGGAACGCGGCGGCGGCGG + Intergenic
1200138579 X:153886368-153886390 CTGGCGGGACCCGTCGGCTGGGG - Intronic