ID: 996769469

View in Genome Browser
Species Human (GRCh38)
Location 5:127071039-127071061
Sequence TAGTGTCCCTGAAGGGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 1, 2: 0, 3: 12, 4: 172}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769469_996769473 23 Left 996769469 5:127071039-127071061 CCAACCTCCCTTCAGGGACACTA 0: 1
1: 1
2: 0
3: 12
4: 172
Right 996769473 5:127071085-127071107 CTGAGCATTTGCAATGTGCCAGG 0: 1
1: 6
2: 82
3: 573
4: 2326

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769469 Original CRISPR TAGTGTCCCTGAAGGGAGGT TGG (reversed) Intronic
904532777 1:31180361-31180383 GAGTGTCTGTGGAGGGAGGTGGG + Exonic
907722137 1:56982027-56982049 TAGAGTCCCTGAAAGGACGTGGG - Intergenic
910049040 1:82955605-82955627 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
910465656 1:87496528-87496550 TAGTGTCCGTGAAGGGGACTGGG + Intergenic
910508156 1:87974009-87974031 GTGTTTCCCTGAAGGAAGGTGGG - Intergenic
913313722 1:117532213-117532235 AAATGTCCCTGAAGGGAGGAAGG - Intergenic
918144427 1:181743090-181743112 CACCGTCCCTGCAGGGAGGTGGG + Intronic
919626228 1:199912874-199912896 GGGGGTCCCAGAAGGGAGGTTGG + Intergenic
919923693 1:202181391-202181413 TGGTGTCAGGGAAGGGAGGTGGG + Intergenic
921126670 1:212184080-212184102 TTGTGTCCCTGAAAGAAGGGAGG + Intergenic
1063430150 10:5980950-5980972 TTGTGTCACTGTAGGGAGGGTGG + Intergenic
1063509968 10:6635188-6635210 TAGAGTCAGTGAAGGGAGATGGG + Intergenic
1066533550 10:36366255-36366277 GAGTGTCCCTGAAGGCATTTTGG + Intergenic
1069467867 10:68657816-68657838 AAATGTCCATGAAGGAAGGTGGG + Intronic
1070995714 10:80778842-80778864 GAGTGTACTTGAAGGAAGGTAGG + Intergenic
1073071581 10:100797877-100797899 TAGTGTCCCTAGAGGCCGGTGGG + Intronic
1073181246 10:101584813-101584835 CAATCTCCCTCAAGGGAGGTGGG + Exonic
1074311803 10:112328772-112328794 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1074638232 10:115345458-115345480 TACTGCCACTGCAGGGAGGTGGG + Intronic
1075467741 10:122664214-122664236 TAGTGACTCAGAAGGTAGGTGGG + Intergenic
1077362197 11:2145684-2145706 TAGTGGCCCTGTAGGGAGGGAGG + Intronic
1080203744 11:29705811-29705833 AAGAGTCAGTGAAGGGAGGTAGG + Intergenic
1080640409 11:34155216-34155238 GAGGGTCTCTGAAGGGATGTTGG + Intronic
1084377943 11:68791275-68791297 CAGTGTCCCCAAAGGGAAGTGGG - Intronic
1088038877 11:105351884-105351906 TTGTGTATATGAAGGGAGGTAGG - Intergenic
1088555465 11:111055992-111056014 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic
1089310659 11:117556202-117556224 CAGTGACCCTGCAGGGAGATGGG + Intronic
1089611499 11:119672030-119672052 CAGTGTCCTGGAAGGGAGGCAGG - Intronic
1090599011 11:128350282-128350304 TGGGGTCCCTGAAGGGATGAAGG - Intergenic
1090965016 11:131590933-131590955 CAGTGGCCCTGAAGTGAGGTGGG + Intronic
1092395600 12:8122668-8122690 TAGTGTCACAGAAAGGAGTTAGG + Intergenic
1093276608 12:17136751-17136773 TAGTGTACAGGAAGGGAAGTGGG - Intergenic
1095208005 12:39460655-39460677 TAGAGTCCCAGGTGGGAGGTGGG - Intergenic
1096042083 12:48526359-48526381 AAGTGTCACTGCAGTGAGGTGGG - Exonic
1096153936 12:49331443-49331465 CAGTGAGCCTGATGGGAGGTGGG + Intronic
1102255770 12:111414144-111414166 TCCTGTCCCTGAAGGGGGGAGGG - Intronic
1102576439 12:113858932-113858954 TAGAGGCCCGCAAGGGAGGTCGG + Intronic
1110303943 13:73962789-73962811 TAGTACCCCTGAAGTGAGTTAGG - Intronic
1110783736 13:79497983-79498005 TAGTGGCACTGAAGAGAAGTGGG + Intronic
1111683585 13:91474299-91474321 TTGAGTCCCTGAAGTGAAGTTGG + Intronic
1114531930 14:23401923-23401945 AAGGGTCCCTGAAGGTAGGGAGG + Intronic
1115938642 14:38583901-38583923 TAGTCTCTCTGAAGGCAGCTAGG + Intergenic
1118034316 14:61849844-61849866 TGATGTTCCTGAAGGGAGGATGG + Intergenic
1119378467 14:74213899-74213921 TGGTGTCCATGAAGGGAGGAGGG - Intergenic
1119637313 14:76285428-76285450 TTGTGTCCCTGCAGTGAAGTGGG - Intergenic
1123147067 14:106142230-106142252 CTGTCTCCCTGCAGGGAGGTTGG + Intergenic
1129739842 15:77984866-77984888 CAGTTTCCCTGAGGGGAGGGTGG + Intronic
1129846195 15:78768746-78768768 CAGTTTCCCTGAGGGGAGGGTGG - Intronic
1129971376 15:79780610-79780632 TAGAGTGCCTGCAGGGAGGGCGG + Intergenic
1130599025 15:85263923-85263945 CAGTTTCCCTGAGGGGAGGGTGG - Intergenic
1132129371 15:99261545-99261567 TAGTGTCCTTTAAAAGAGGTCGG - Intronic
1133367591 16:5223082-5223104 AAGTGTCCCTGATGGGAGTTCGG - Intergenic
1133586972 16:7205115-7205137 TACTATCAGTGAAGGGAGGTGGG - Intronic
1133976368 16:10602155-10602177 TAGGGGACCTGAAGGGAGCTGGG - Intergenic
1135323886 16:21513798-21513820 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1136335371 16:29607066-29607088 CAGGGTCCCTGGAGTGAGGTGGG - Intergenic
1139952093 16:70677460-70677482 TTCTGGCCATGAAGGGAGGTGGG + Intronic
1141598750 16:85112754-85112776 CAGCTTCCCTGAAGGGAGGGAGG - Intergenic
1143356800 17:6335653-6335675 TGGTGTCCCTGAGGGGAGAGAGG + Intergenic
1143542010 17:7574412-7574434 TGGTTTCCCTAAAGGGAGGAGGG + Intronic
1145025843 17:19467295-19467317 TAGTGCCTCTGTTGGGAGGTGGG + Intergenic
1146887705 17:36483500-36483522 TAATGTCCGGGAAAGGAGGTGGG - Intergenic
1147662646 17:42125231-42125253 TGGTTTCCCAGCAGGGAGGTGGG + Intronic
1150130468 17:62666299-62666321 CAGTGTTCCTGGAGGGAGGCTGG + Intronic
1150440847 17:65190116-65190138 TAGTGACACTGAAGGGTGGGAGG + Intronic
1151703935 17:75757090-75757112 TAGAGTCCCAGGATGGAGGTAGG + Exonic
1152991999 18:372115-372137 TAGTGTCCCTGAATGGGGGGAGG - Intronic
1156341647 18:36214966-36214988 GAGTGCCCCTGCAGGGAGATGGG - Intronic
1160899673 19:1421452-1421474 TCGTGTCCCAGTAGGGTGGTTGG + Intronic
1163069353 19:14825528-14825550 GAGTGTCCCTCAAGGGAACTTGG + Intronic
1163455952 19:17405754-17405776 CAGTTTCCCAGAAAGGAGGTGGG + Intronic
1164631734 19:29766269-29766291 GAGTGTCACTGCAGGGAGGAGGG - Intergenic
1166037763 19:40181579-40181601 TAGGCTCCCTGAATGGAGGCTGG + Intergenic
1166141986 19:40810173-40810195 TAGTTTCCCTACAGGGAGATTGG + Intronic
1167615327 19:50529949-50529971 AAGGGACCCTGAAGGGAGGGAGG - Intronic
1167810575 19:51826315-51826337 TAGTTTTCCTGAAAGGAGTTTGG + Intergenic
924998610 2:386270-386292 CAGTTTCCCTGAGAGGAGGTGGG + Intergenic
925306653 2:2851536-2851558 CAGTGTCCCGGAGGGGAGGGAGG - Intergenic
927697292 2:25247026-25247048 GAGTGTCCCTGCTGGGAGCTCGG - Intronic
933203346 2:79476852-79476874 TAGTGCCCCAGAAGACAGGTGGG + Intronic
935284103 2:101548466-101548488 TACTGTCCCTAAAGGGAGTAGGG + Intergenic
936907629 2:117555430-117555452 TAGTTTCCCTGAGGTGAGGTAGG - Intergenic
941935364 2:170977551-170977573 GAGAGTCCGTGAAGGGAGATAGG + Intergenic
945112208 2:206370716-206370738 TTGTGTCCCTGATGGATGGTGGG + Intergenic
946387237 2:219391373-219391395 TGATGTCACTGAAGGGAGTTGGG + Intronic
946410391 2:219512687-219512709 TAGTGTCCCAGAAGGGAAAGTGG - Intergenic
947134508 2:226963849-226963871 TAGTTTTCATGATGGGAGGTTGG - Intronic
947914535 2:233822866-233822888 TAGTGACCCTGAAGGGAGGTGGG - Exonic
948254209 2:236554141-236554163 TATTTTCCCAGAAGGGAGGAAGG - Intergenic
948976401 2:241466319-241466341 TAGTGTCGCTGAGGGGTGGCTGG - Intronic
1169060746 20:2658878-2658900 GAGAGCCCATGAAGGGAGGTAGG + Intronic
1169865869 20:10199397-10199419 TGGTCTCCCTGAAGTCAGGTAGG - Intergenic
1178248123 21:30973716-30973738 TAGCCTCCCAGAAGGGAGTTTGG - Intergenic
1179773549 21:43643459-43643481 TAGTTTCCCTGAGAGCAGGTTGG + Intronic
1183698952 22:39438828-39438850 TGATTTCACTGAAGGGAGGTGGG - Intergenic
950198468 3:11026220-11026242 TGGAGTCCCTGAAGAGAGGGAGG - Exonic
952110869 3:30122756-30122778 AAGTGTCCCTTAATGGAGGAAGG + Intergenic
953076662 3:39577927-39577949 TAGAGTCAGTGAAGGGAGATAGG + Intergenic
958743269 3:98100704-98100726 TAGTTTTCCTGAAGGAAAGTTGG - Intergenic
959147413 3:102565629-102565651 TAGAATCCCTGAGGGGAGATTGG - Intergenic
961452414 3:127008363-127008385 TAGCGTGCCTGAAGGCTGGTGGG + Intronic
961801014 3:129449441-129449463 TAATTTCCCTGAGGGGAGGGAGG + Intronic
962390884 3:134971633-134971655 TAGTGTCCCTGCATTGAGGAAGG - Intronic
963164397 3:142186195-142186217 TTGTGTCCCTCACAGGAGGTAGG + Exonic
966120487 3:176514178-176514200 TAGTTTCCTTAAAGGGATGTGGG + Intergenic
968914906 4:3493178-3493200 TAGTGGGCCCGCAGGGAGGTGGG - Exonic
968934870 4:3604745-3604767 TAGGGACCTGGAAGGGAGGTGGG - Intergenic
969072090 4:4547652-4547674 TAGAGTCTCTGAAGGGAGCGTGG + Intergenic
970551205 4:17182914-17182936 CAGTGTCCCCGAAGGCATGTTGG - Intergenic
975201327 4:71593304-71593326 TAGAGTCCCTGAACATAGGTTGG - Intergenic
976669080 4:87631748-87631770 TATTGACCATGAAGGGTGGTAGG + Intergenic
977453433 4:97227033-97227055 TAGTGTCCAGGAATGGGGGTAGG + Intronic
978782059 4:112566750-112566772 TTGTGTCCCTGAAGTGATTTTGG + Intronic
980491603 4:133534301-133534323 TAGAGTCAGTGAAGGGAGATAGG + Intergenic
982328909 4:154159333-154159355 AAGTGACGCTGAAGGGAGGAGGG + Intergenic
982359359 4:154502947-154502969 TAGTGGCCCTAAAGGGAAATAGG + Intergenic
982380076 4:154740636-154740658 CAGTGTCCCCGCAGGGTGGTCGG - Intronic
983640668 4:169941603-169941625 TAGAGTCAGTGAAGGGAGATGGG - Intergenic
985109477 4:186534238-186534260 GAGAGTCCCTGCACGGAGGTTGG + Exonic
985572173 5:652890-652912 TCGTGCCCATGCAGGGAGGTGGG + Intronic
987284297 5:16440601-16440623 TAGTGTCCAGGAATGGAGTTGGG + Intergenic
988453065 5:31362453-31362475 TAGTTTGCCTGAAGTGAGGAAGG - Intergenic
990023876 5:51161431-51161453 TAGTGTCACTCAAGAGAGATGGG + Intergenic
992186625 5:74250558-74250580 TAGTGTCCCACTAGGGAAGTTGG - Intergenic
993591176 5:89796907-89796929 TAGTATCCCGGATGGGATGTTGG + Intergenic
996769469 5:127071039-127071061 TAGTGTCCCTGAAGGGAGGTTGG - Intronic
996772687 5:127101620-127101642 TAGTGTACATGAAGGGGAGTGGG - Intergenic
997429289 5:133826440-133826462 TAGGGTCCCTGGAGGGAGTCTGG - Intergenic
998446945 5:142205871-142205893 TAGTGGCCAGGAGGGGAGGTGGG - Intergenic
998800907 5:145867916-145867938 GAGGCTCCCTGAAGGGAGGCTGG - Intronic
999665202 5:153905573-153905595 TTGTTTCCCTGAAGGGAAGAAGG + Intergenic
1000155782 5:158550110-158550132 TAGTGTCCCAGAGGGGCTGTGGG + Intergenic
1002474007 5:179453717-179453739 TGGAGTCACTGAAGGGAGGGTGG - Intergenic
1003093750 6:3126059-3126081 TAGTGGGCCTGCAGGGAGCTTGG - Intronic
1006964385 6:37967769-37967791 TAGTGTCAAAGATGGGAGGTTGG - Intronic
1007520907 6:42451536-42451558 TAGATTTCCTGAAGGGAGGGTGG - Intronic
1008821107 6:55631331-55631353 TGGTGTTCCTGAAGGGTGGGTGG + Intergenic
1011918155 6:92535996-92536018 TAGAGGCCCTGAGGGGAGCTAGG + Intergenic
1012557056 6:100526502-100526524 TATAGTCCTTGAAGGGAGATTGG + Intronic
1015364731 6:132385002-132385024 TAGTATCACTGGAGAGAGGTGGG + Intronic
1015578968 6:134702701-134702723 TGGTGTTCCTGCAGGGAGGGTGG + Intergenic
1017044367 6:150333689-150333711 GAGTGTCCCTGAAGAGTGCTGGG - Intergenic
1017459665 6:154637214-154637236 TGCTGTCTCTGCAGGGAGGTGGG - Intergenic
1017821841 6:158054569-158054591 TAGTGTCCCTGAAGGCATAAAGG + Intronic
1018143441 6:160862236-160862258 CAGTGTCGAGGAAGGGAGGTGGG + Intergenic
1019917928 7:4145200-4145222 TGGGGTCCCTGGAGGGAGCTGGG + Intronic
1022036562 7:26540004-26540026 TAGTGGCCCTGCAGAGAGGTGGG + Intergenic
1023596010 7:41829982-41830004 TGGTGGCCAGGAAGGGAGGTAGG + Intergenic
1025212125 7:57025805-57025827 TGGGCTCCCTGCAGGGAGGTGGG + Intergenic
1025659829 7:63551023-63551045 TGGGCTCCCTGCAGGGAGGTGGG - Intergenic
1026939868 7:74281367-74281389 CAGTGACCCTGCAGGGAGGGTGG + Intergenic
1031343950 7:120641355-120641377 TAGTGTCCCTGGAGACAGGCAGG + Intronic
1031353191 7:120760639-120760661 AAGGGGCCCTGACGGGAGGTGGG + Intergenic
1032887350 7:136155023-136155045 TGGTGTCCCTGAAGGCAAATGGG - Intergenic
1033144611 7:138860816-138860838 CAGTGTCACGGAATGGAGGTGGG - Intronic
1033899419 7:146116792-146116814 TAGGGTTCTTGAAGGGAGATGGG - Exonic
1035166100 7:156990850-156990872 TTGTGTCCCTGAAAGGACGTAGG + Intergenic
1035344692 7:158190496-158190518 CAGTGGTCCTGATGGGAGGTGGG + Intronic
1035528452 8:332894-332916 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1035528468 8:332939-332961 GGGTGTCCCTGGAGGGAGGGCGG + Intergenic
1036988189 8:13560756-13560778 TAGTGTCCCTGTGGGGGGGGAGG + Intergenic
1043587291 8:81783916-81783938 CAGTTTCACTGTAGGGAGGTGGG + Intergenic
1044524759 8:93239959-93239981 TATTGCCCCTGCTGGGAGGTGGG - Intergenic
1044904562 8:96986979-96987001 TAGTGGCCCTGAATGGAGCAGGG + Intronic
1045112907 8:98950106-98950128 TAAGGTCGCGGAAGGGAGGTGGG - Intronic
1047119753 8:121888280-121888302 TATTGTCCATGAAGAGAGATAGG + Intergenic
1047605337 8:126468685-126468707 TTCTGTCCCTGAAGGTTGGTGGG + Intergenic
1048468533 8:134687050-134687072 TTGTGTCCCTGCAGGGTGGAGGG - Intronic
1048538680 8:135322348-135322370 TCATGTCCCTGAAGGAAGTTAGG - Intergenic
1048932536 8:139326411-139326433 TAGTGGCCAGGAAGGGAGATAGG - Intergenic
1051112712 9:13657465-13657487 TGGTATCCCTGAAGGGGGGTGGG + Intergenic
1054455303 9:65427233-65427255 TAGGGACCTGGAAGGGAGGTGGG + Intergenic
1054847482 9:69811918-69811940 TAGTGACCATGAAGGGATGAAGG - Intergenic
1057216917 9:93234250-93234272 CAGTGTCCCTGAATGAGGGTGGG - Intronic
1057904592 9:98974325-98974347 TCCTGTCCCTCCAGGGAGGTGGG + Intronic
1059305681 9:113351254-113351276 TCCTTTGCCTGAAGGGAGGTGGG + Intronic
1061469317 9:130810702-130810724 TGGAGTCCCTGAAGGAAGGGAGG + Intronic
1061650421 9:132043867-132043889 CAGTTGCCCTGAAGGAAGGTGGG - Intronic
1187003042 X:15201630-15201652 GAGAGTCCCTGAAGGGATGAGGG + Intergenic
1187344544 X:18451021-18451043 TAGGGTCCCTGAAGGGTGGCAGG + Intronic
1189181069 X:39004937-39004959 CAGTGACCCTGAAGGCAGGAGGG + Intergenic
1192863596 X:75106841-75106863 TGGTGTCCTTGAAGGGAAGGGGG - Intronic
1194670863 X:96730884-96730906 GAGAGTCAGTGAAGGGAGGTAGG + Intronic
1198117991 X:133563057-133563079 TGTTGTCCCTGAAGAGGGGTAGG + Intronic
1198628847 X:138612062-138612084 TTGTGTCTCTGAAGGGAGTGTGG + Intergenic
1201581860 Y:15518085-15518107 GAGAGTCAGTGAAGGGAGGTAGG - Intergenic