ID: 996769726

View in Genome Browser
Species Human (GRCh38)
Location 5:127073481-127073503
Sequence CGGAAGTGCCCGGCGCAGGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769726_996769732 -2 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769726_996769735 5 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769735 5:127073509-127073531 ACCCACCAGGCGCCGGCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 192
996769726_996769730 -8 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769730 5:127073496-127073518 CACTTCCGCCCGCACCCACCAGG 0: 1
1: 0
2: 0
3: 11
4: 161
996769726_996769745 29 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769726 Original CRISPR CGGAAGTGCCCGGCGCAGGG CGG (reversed) Exonic