ID: 996769727

View in Genome Browser
Species Human (GRCh38)
Location 5:127073484-127073506
Sequence GGGCGGAAGTGCCCGGCGCA GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 96}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769727_996769732 -5 Left 996769727 5:127073484-127073506 CCCTGCGCCGGGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769727_996769735 2 Left 996769727 5:127073484-127073506 CCCTGCGCCGGGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 996769735 5:127073509-127073531 ACCCACCAGGCGCCGGCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 192
996769727_996769745 26 Left 996769727 5:127073484-127073506 CCCTGCGCCGGGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769727 Original CRISPR GGGCGGAAGTGCCCGGCGCA GGG (reversed) Exonic