ID: 996769728

View in Genome Browser
Species Human (GRCh38)
Location 5:127073485-127073507
Sequence CGGGCGGAAGTGCCCGGCGC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 93}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769728_996769735 1 Left 996769728 5:127073485-127073507 CCTGCGCCGGGCACTTCCGCCCG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 996769735 5:127073509-127073531 ACCCACCAGGCGCCGGCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 192
996769728_996769745 25 Left 996769728 5:127073485-127073507 CCTGCGCCGGGCACTTCCGCCCG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769728_996769732 -6 Left 996769728 5:127073485-127073507 CCTGCGCCGGGCACTTCCGCCCG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769728 Original CRISPR CGGGCGGAAGTGCCCGGCGC AGG (reversed) Exonic