ID: 996769729

View in Genome Browser
Species Human (GRCh38)
Location 5:127073491-127073513
Sequence TGGGTGCGGGCGGAAGTGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 210}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769729_996769735 -5 Left 996769729 5:127073491-127073513 CCGGGCACTTCCGCCCGCACCCA 0: 1
1: 0
2: 2
3: 8
4: 210
Right 996769735 5:127073509-127073531 ACCCACCAGGCGCCGGCCCCAGG 0: 1
1: 0
2: 2
3: 14
4: 192
996769729_996769745 19 Left 996769729 5:127073491-127073513 CCGGGCACTTCCGCCCGCACCCA 0: 1
1: 0
2: 2
3: 8
4: 210
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769729 Original CRISPR TGGGTGCGGGCGGAAGTGCC CGG (reversed) Exonic