ID: 996769731

View in Genome Browser
Species Human (GRCh38)
Location 5:127073501-127073523
Sequence CGGCGCCTGGTGGGTGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 380
Summary {0: 1, 1: 1, 2: 0, 3: 29, 4: 349}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769731_996769745 9 Left 996769731 5:127073501-127073523 CCGCCCGCACCCACCAGGCGCCG 0: 1
1: 1
2: 0
3: 29
4: 349
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769731_996769752 25 Left 996769731 5:127073501-127073523 CCGCCCGCACCCACCAGGCGCCG 0: 1
1: 1
2: 0
3: 29
4: 349
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769731_996769751 24 Left 996769731 5:127073501-127073523 CCGCCCGCACCCACCAGGCGCCG 0: 1
1: 1
2: 0
3: 29
4: 349
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769731 Original CRISPR CGGCGCCTGGTGGGTGCGGG CGG (reversed) Intergenic