ID: 996769732

View in Genome Browser
Species Human (GRCh38)
Location 5:127073502-127073524
Sequence CGCCCGCACCCACCAGGCGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 0, 2: 0, 3: 20, 4: 208}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769727_996769732 -5 Left 996769727 5:127073484-127073506 CCCTGCGCCGGGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769723_996769732 7 Left 996769723 5:127073472-127073494 CCTCTGCTTCCGCCCTGCGCCGG 0: 1
1: 0
2: 1
3: 23
4: 187
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769720_996769732 23 Left 996769720 5:127073456-127073478 CCTCACGCCGCCAACGCCTCTGC 0: 1
1: 0
2: 0
3: 15
4: 180
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769726_996769732 -2 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769722_996769732 13 Left 996769722 5:127073466-127073488 CCAACGCCTCTGCTTCCGCCCTG 0: 1
1: 0
2: 0
3: 20
4: 255
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769728_996769732 -6 Left 996769728 5:127073485-127073507 CCTGCGCCGGGCACTTCCGCCCG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769719_996769732 29 Left 996769719 5:127073450-127073472 CCTGAGCCTCACGCCGCCAACGC 0: 1
1: 0
2: 0
3: 3
4: 75
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208
996769721_996769732 16 Left 996769721 5:127073463-127073485 CCGCCAACGCCTCTGCTTCCGCC 0: 1
1: 1
2: 3
3: 28
4: 396
Right 996769732 5:127073502-127073524 CGCCCGCACCCACCAGGCGCCGG 0: 1
1: 0
2: 0
3: 20
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769732 Original CRISPR CGCCCGCACCCACCAGGCGC CGG Intergenic