ID: 996769733

View in Genome Browser
Species Human (GRCh38)
Location 5:127073504-127073526
Sequence GGCCGGCGCCTGGTGGGTGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 359
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 329}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769733_996769752 22 Left 996769733 5:127073504-127073526 CCCGCACCCACCAGGCGCCGGCC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769733_996769751 21 Left 996769733 5:127073504-127073526 CCCGCACCCACCAGGCGCCGGCC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84
996769733_996769745 6 Left 996769733 5:127073504-127073526 CCCGCACCCACCAGGCGCCGGCC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769733 Original CRISPR GGCCGGCGCCTGGTGGGTGC GGG (reversed) Intergenic