ID: 996769734

View in Genome Browser
Species Human (GRCh38)
Location 5:127073505-127073527
Sequence GGGCCGGCGCCTGGTGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 413
Summary {0: 1, 1: 0, 2: 5, 3: 43, 4: 364}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769734_996769745 5 Left 996769734 5:127073505-127073527 CCGCACCCACCAGGCGCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 364
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769734_996769751 20 Left 996769734 5:127073505-127073527 CCGCACCCACCAGGCGCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 364
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84
996769734_996769752 21 Left 996769734 5:127073505-127073527 CCGCACCCACCAGGCGCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 364
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769734 Original CRISPR GGGCCGGCGCCTGGTGGGTG CGG (reversed) Intergenic