ID: 996769736

View in Genome Browser
Species Human (GRCh38)
Location 5:127073510-127073532
Sequence GCCTGGGGCCGGCGCCTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 4, 3: 19, 4: 306}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769736_996769745 0 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769736_996769754 30 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769736_996769752 16 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769736_996769751 15 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769736 Original CRISPR GCCTGGGGCCGGCGCCTGGT GGG (reversed) Intergenic