ID: 996769737

View in Genome Browser
Species Human (GRCh38)
Location 5:127073511-127073533
Sequence GGCCTGGGGCCGGCGCCTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 666
Summary {0: 1, 1: 0, 2: 3, 3: 66, 4: 596}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769737_996769754 29 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769737_996769752 15 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769737_996769751 14 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84
996769737_996769745 -1 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769737 Original CRISPR GGCCTGGGGCCGGCGCCTGG TGG (reversed) Intergenic