ID: 996769738

View in Genome Browser
Species Human (GRCh38)
Location 5:127073514-127073536
Sequence CGGGGCCTGGGGCCGGCGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1220
Summary {0: 1, 1: 0, 2: 12, 3: 119, 4: 1088}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769738_996769745 -4 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769738_996769751 11 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769751 5:127073548-127073570 CACGCCGGCAGCACTGCCGCTGG 0: 1
1: 0
2: 0
3: 8
4: 84
996769738_996769756 29 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769756 5:127073566-127073588 GCTGGGCGTTCTATCTCAGGTGG 0: 1
1: 0
2: 0
3: 6
4: 89
996769738_996769754 26 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769738_996769752 12 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769738 Original CRISPR CGGGGCCTGGGGCCGGCGCC TGG (reversed) Intergenic