ID: 996769745

View in Genome Browser
Species Human (GRCh38)
Location 5:127073533-127073555
Sequence CCCGCACTTCCGCCCCACGC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 111}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769728_996769745 25 Left 996769728 5:127073485-127073507 CCTGCGCCGGGCACTTCCGCCCG 0: 1
1: 0
2: 0
3: 7
4: 93
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769738_996769745 -4 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769733_996769745 6 Left 996769733 5:127073504-127073526 CCCGCACCCACCAGGCGCCGGCC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769736_996769745 0 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769731_996769745 9 Left 996769731 5:127073501-127073523 CCGCCCGCACCCACCAGGCGCCG 0: 1
1: 1
2: 0
3: 29
4: 349
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769729_996769745 19 Left 996769729 5:127073491-127073513 CCGGGCACTTCCGCCCGCACCCA 0: 1
1: 0
2: 2
3: 8
4: 210
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769734_996769745 5 Left 996769734 5:127073505-127073527 CCGCACCCACCAGGCGCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 364
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769727_996769745 26 Left 996769727 5:127073484-127073506 CCCTGCGCCGGGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 5
4: 96
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769726_996769745 29 Left 996769726 5:127073481-127073503 CCGCCCTGCGCCGGGCACTTCCG 0: 1
1: 0
2: 0
3: 4
4: 145
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111
996769737_996769745 -1 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769745 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 1
3: 10
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769745 Original CRISPR CCCGCACTTCCGCCCCACGC CGG Intergenic