ID: 996769752

View in Genome Browser
Species Human (GRCh38)
Location 5:127073549-127073571
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 48
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 46}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769742_996769752 -1 Left 996769742 5:127073527-127073549 CCAGGCCCCGCACTTCCGCCCCA 0: 1
1: 0
2: 1
3: 24
4: 324
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769746_996769752 -8 Left 996769746 5:127073534-127073556 CCGCACTTCCGCCCCACGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 197
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769744_996769752 -7 Left 996769744 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 2
3: 7
4: 151
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769731_996769752 25 Left 996769731 5:127073501-127073523 CCGCCCGCACCCACCAGGCGCCG 0: 1
1: 1
2: 0
3: 29
4: 349
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769733_996769752 22 Left 996769733 5:127073504-127073526 CCCGCACCCACCAGGCGCCGGCC 0: 1
1: 0
2: 1
3: 28
4: 329
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769743_996769752 -6 Left 996769743 5:127073532-127073554 CCCCGCACTTCCGCCCCACGCCG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769740_996769752 1 Left 996769740 5:127073525-127073547 CCCCAGGCCCCGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 29
4: 353
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769738_996769752 12 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769739_996769752 5 Left 996769739 5:127073521-127073543 CCGGCCCCAGGCCCCGCACTTCC 0: 1
1: 0
2: 5
3: 104
4: 822
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769734_996769752 21 Left 996769734 5:127073505-127073527 CCGCACCCACCAGGCGCCGGCCC 0: 1
1: 0
2: 5
3: 43
4: 364
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769741_996769752 0 Left 996769741 5:127073526-127073548 CCCAGGCCCCGCACTTCCGCCCC 0: 1
1: 0
2: 2
3: 25
4: 346
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769737_996769752 15 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46
996769736_996769752 16 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769752 5:127073549-127073571 ACGCCGGCAGCACTGCCGCTGGG 0: 1
1: 0
2: 0
3: 1
4: 46

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type