ID: 996769754

View in Genome Browser
Species Human (GRCh38)
Location 5:127073563-127073585
Sequence GCCGCTGGGCGTTCTATCTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 14 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996769741_996769754 14 Left 996769741 5:127073526-127073548 CCCAGGCCCCGCACTTCCGCCCC 0: 1
1: 0
2: 2
3: 25
4: 346
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769742_996769754 13 Left 996769742 5:127073527-127073549 CCAGGCCCCGCACTTCCGCCCCA 0: 1
1: 0
2: 1
3: 24
4: 324
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769739_996769754 19 Left 996769739 5:127073521-127073543 CCGGCCCCAGGCCCCGCACTTCC 0: 1
1: 0
2: 5
3: 104
4: 822
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769740_996769754 15 Left 996769740 5:127073525-127073547 CCCCAGGCCCCGCACTTCCGCCC 0: 1
1: 0
2: 1
3: 29
4: 353
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769748_996769754 -5 Left 996769748 5:127073545-127073567 CCCCACGCCGGCAGCACTGCCGC 0: 1
1: 0
2: 1
3: 8
4: 119
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769738_996769754 26 Left 996769738 5:127073514-127073536 CCAGGCGCCGGCCCCAGGCCCCG 0: 1
1: 0
2: 12
3: 119
4: 1088
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769749_996769754 -6 Left 996769749 5:127073546-127073568 CCCACGCCGGCAGCACTGCCGCT 0: 1
1: 0
2: 0
3: 9
4: 69
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769747_996769754 -2 Left 996769747 5:127073542-127073564 CCGCCCCACGCCGGCAGCACTGC 0: 1
1: 0
2: 3
3: 19
4: 230
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769744_996769754 7 Left 996769744 5:127073533-127073555 CCCGCACTTCCGCCCCACGCCGG 0: 1
1: 0
2: 2
3: 7
4: 151
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769750_996769754 -7 Left 996769750 5:127073547-127073569 CCACGCCGGCAGCACTGCCGCTG 0: 1
1: 0
2: 0
3: 19
4: 130
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769746_996769754 6 Left 996769746 5:127073534-127073556 CCGCACTTCCGCCCCACGCCGGC 0: 1
1: 0
2: 0
3: 9
4: 197
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769737_996769754 29 Left 996769737 5:127073511-127073533 CCACCAGGCGCCGGCCCCAGGCC 0: 1
1: 0
2: 3
3: 66
4: 596
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769736_996769754 30 Left 996769736 5:127073510-127073532 CCCACCAGGCGCCGGCCCCAGGC 0: 1
1: 0
2: 4
3: 19
4: 306
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49
996769743_996769754 8 Left 996769743 5:127073532-127073554 CCCCGCACTTCCGCCCCACGCCG 0: 1
1: 0
2: 1
3: 9
4: 144
Right 996769754 5:127073563-127073585 GCCGCTGGGCGTTCTATCTCAGG 0: 1
1: 0
2: 0
3: 2
4: 49

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996769754 Original CRISPR GCCGCTGGGCGTTCTATCTC AGG Intergenic