ID: 996776905

View in Genome Browser
Species Human (GRCh38)
Location 5:127142741-127142763
Sequence GGGGGCCTTAAGTAAAGATC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996776905_996776911 -5 Left 996776905 5:127142741-127142763 CCGGATCTTTACTTAAGGCCCCC No data
Right 996776911 5:127142759-127142781 CCCCCCGGGAGGAGGTAACCAGG No data
996776905_996776916 0 Left 996776905 5:127142741-127142763 CCGGATCTTTACTTAAGGCCCCC No data
Right 996776916 5:127142764-127142786 CGGGAGGAGGTAACCAGGATAGG No data
996776905_996776920 22 Left 996776905 5:127142741-127142763 CCGGATCTTTACTTAAGGCCCCC No data
Right 996776920 5:127142786-127142808 GCAGAGGGCCACATTCCTCCTGG No data
996776905_996776918 7 Left 996776905 5:127142741-127142763 CCGGATCTTTACTTAAGGCCCCC No data
Right 996776918 5:127142771-127142793 AGGTAACCAGGATAGGCAGAGGG No data
996776905_996776917 6 Left 996776905 5:127142741-127142763 CCGGATCTTTACTTAAGGCCCCC No data
Right 996776917 5:127142770-127142792 GAGGTAACCAGGATAGGCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996776905 Original CRISPR GGGGGCCTTAAGTAAAGATC CGG (reversed) Intergenic
No off target data available for this crispr