ID: 996778634

View in Genome Browser
Species Human (GRCh38)
Location 5:127159877-127159899
Sequence CTGGACAAAATAGCCATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996778625_996778634 30 Left 996778625 5:127159824-127159846 CCTATGAGGAGGAATAGGTTAGG No data
Right 996778634 5:127159877-127159899 CTGGACAAAATAGCCATGCTGGG No data
996778629_996778634 5 Left 996778629 5:127159849-127159871 CCTGCTTAAAGAAGTAGTCAGGC No data
Right 996778634 5:127159877-127159899 CTGGACAAAATAGCCATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996778634 Original CRISPR CTGGACAAAATAGCCATGCT GGG Intergenic
No off target data available for this crispr