ID: 996779536

View in Genome Browser
Species Human (GRCh38)
Location 5:127170943-127170965
Sequence TCCAACATGCAGTTGTTGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 136}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996779536_996779540 26 Left 996779536 5:127170943-127170965 CCCTGCAACAACTGCATGTTGGA 0: 1
1: 0
2: 2
3: 9
4: 136
Right 996779540 5:127170992-127171014 CAGTAGAAGCATGCCCTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996779536 Original CRISPR TCCAACATGCAGTTGTTGCA GGG (reversed) Intergenic
906028312 1:42695152-42695174 TTCAACATGTAGTTGTTTCTTGG + Intronic
908879757 1:68717859-68717881 AGCAACATACAGTTATTGCAAGG - Intergenic
909857702 1:80560051-80560073 TTCAACATGATGGTGTTGCAAGG + Intergenic
910557580 1:88552991-88553013 GCCAACATGCAGTTGTGTCGGGG - Intergenic
911367989 1:96962853-96962875 TCCAATATGCAGTTATTTCTGGG + Intergenic
912044292 1:105435196-105435218 ATCAAAATGCAGTTTTTGCAAGG - Intergenic
912533326 1:110341806-110341828 TCCAACATGCATCTGTTGCAGGG + Exonic
914831069 1:151171374-151171396 TCTTACATGCACCTGTTGCATGG - Intronic
918729554 1:187974034-187974056 ACCAGCATCCACTTGTTGCAGGG - Intergenic
924905211 1:248444822-248444844 TCAAATATGCATTTGTTTCAGGG - Intergenic
924922677 1:248647227-248647249 TCAAATATGCATTTGTTTCAGGG + Intergenic
1062886546 10:1020896-1020918 TCCCACATGCATTTTTTCCAGGG - Exonic
1062952978 10:1518876-1518898 TACCACATGCAGATGTTACATGG - Intronic
1062953006 10:1519286-1519308 TACCACATGCAGATGTTACATGG - Intronic
1064937132 10:20690576-20690598 GACAACATTCAGTTCTTGCAGGG - Intergenic
1065970626 10:30803436-30803458 TCCAAGATCAAGGTGTTGCATGG - Intergenic
1066515811 10:36159123-36159145 ACCAGCATGTGGTTGTTGCAGGG + Intergenic
1067316929 10:45176709-45176731 TCCAATTTGCAGTTTTAGCATGG - Intergenic
1070362104 10:75700742-75700764 TCCAATATGTATTTGTTGGATGG + Intronic
1073090060 10:100928754-100928776 TACTACATGGAGTTGTTGTAAGG + Intronic
1074494197 10:113964773-113964795 TTCAACATGGAGTTGTTATAGGG + Intergenic
1077548144 11:3185510-3185532 TCCAACCTACAAATGTTGCAGGG + Intergenic
1078095752 11:8295862-8295884 CCCAACATGCAAGTGCTGCAAGG + Intergenic
1078604639 11:12764466-12764488 TACAACCTGCAGTTGTGGTAGGG + Intronic
1080695705 11:34601321-34601343 TCCAGCAGGCAGATGTGGCAGGG - Intergenic
1085761509 11:79245205-79245227 TCAAACATGCAATGGCTGCAGGG - Intronic
1086648168 11:89250820-89250842 TTCAACATACAAATGTTGCAGGG + Intronic
1098100598 12:67012088-67012110 TACAATAAGCAGTTGTTGAATGG + Intergenic
1098149644 12:67533372-67533394 TCCAGCATCTAATTGTTGCATGG + Intergenic
1098451397 12:70622144-70622166 GCCAACATACAGTTATTCCATGG + Intronic
1099567061 12:84264740-84264762 TCCAGGAGGCAGTGGTTGCAGGG + Intergenic
1101945296 12:109131693-109131715 TTCAACAGGCAGCTGTTGCTTGG + Intronic
1105612891 13:21984813-21984835 TCCTAAATGCAGTTGATGAAAGG - Intergenic
1106401995 13:29440372-29440394 TGCAAGATGCAGATGTTCCATGG + Intronic
1107440798 13:40425678-40425700 TCCATCATGCAGTTAATGAAGGG + Intergenic
1108398031 13:50008950-50008972 TCCAAGAGGCAGAAGTTGCAGGG + Intronic
1109658533 13:65427770-65427792 TCCAACATACAGTAGTGGAATGG + Intergenic
1110306310 13:73991348-73991370 TCTAACATGCACTTGGTGCATGG - Intronic
1117416228 14:55499116-55499138 TCCAAAATGCAGTGGTTTAAAGG + Intergenic
1119899829 14:78250257-78250279 TACATCATGGAGTTGTTGAAAGG + Intronic
1138372555 16:56538953-56538975 TACAACATCAAGTTGTTGCGAGG - Intergenic
1139007299 16:62588291-62588313 TCCAAAATCAAGGTGTTGCAGGG + Intergenic
1140834054 16:78777149-78777171 TCCAACATGCCATTGTTCAATGG + Intronic
1141261879 16:82461929-82461951 TCTAACATTCAGTTGTTGAGAGG + Intergenic
1144350485 17:14390568-14390590 GACAACATGCAGTTTTTCCAAGG - Intergenic
1144360261 17:14485475-14485497 TGCATCATGAAGTTGTGGCAAGG - Intergenic
1145050411 17:19655132-19655154 TTCTACATGCAGTTGCTACAGGG + Intronic
1145989084 17:29067502-29067524 GCCAACCTGCAGTTGATGCCAGG + Intergenic
1146017933 17:29248678-29248700 TTCGACATGCAGTTATTGTAAGG - Intronic
1150798839 17:68262535-68262557 TCCATCAGGCAGTTCATGCAGGG + Intronic
1151382239 17:73733935-73733957 TCCAAAATCGAGATGTTGCAGGG + Intergenic
1153801675 18:8676343-8676365 TCCTGCATGCTGTTGTTCCAAGG - Intergenic
1155071367 18:22319502-22319524 TCCATCATACGGTTGTTGTAAGG + Intergenic
1156305282 18:35873422-35873444 TCCATCAGGCATTTCTTGCAGGG - Intergenic
1157185232 18:45534575-45534597 TCCGACATGCTATTGTTTCAAGG - Intronic
1157862185 18:51151494-51151516 TCCAAAATGGAGGTGTTGCAGGG - Intergenic
1160475747 18:79185207-79185229 TTAAACGTGCAGTTATTGCATGG + Intronic
1163509844 19:17727893-17727915 TCCACCATGCAGATGCTGGATGG - Exonic
1164681841 19:30139755-30139777 TGCAACATGCAATTCTTGCTGGG - Intergenic
927610952 2:24539932-24539954 TCCTACATGCAGTTCTCACATGG - Intronic
927748101 2:25641223-25641245 TCTAAAATGCTGTTGTGGCACGG - Intronic
928600142 2:32896602-32896624 TCCAACATGCAGATTTTGGGAGG - Intergenic
929542272 2:42831444-42831466 TACCTCATGTAGTTGTTGCAAGG + Intergenic
929542460 2:42832902-42832924 TGTCTCATGCAGTTGTTGCAAGG - Intergenic
932793620 2:74676287-74676309 ATCAACATTCAGTTGTTGGATGG - Intronic
935386866 2:102509147-102509169 TTCAAAATCCAGTTGTTGCAGGG + Intronic
939968492 2:148634757-148634779 CCCAACAAGCTGTTCTTGCAGGG + Intergenic
945202109 2:207292631-207292653 TCCAAAATCAAGGTGTTGCAGGG - Intergenic
945205152 2:207323595-207323617 TCAATCATGCAGTTTGTGCATGG - Intergenic
945730825 2:213531497-213531519 TGCAAGATGCAGTTGTTTCATGG + Intronic
947332105 2:229040447-229040469 ACCAACATGCAGTGGTTGCTTGG + Intronic
948250550 2:236525091-236525113 TCCTACGTGGGGTTGTTGCAAGG + Intergenic
1170742783 20:19072762-19072784 TCCTACATGCAATTGTTTCAGGG - Intergenic
1171163409 20:22949486-22949508 TCCAAGTTGCAGTTGTTAAAAGG - Intergenic
1172342935 20:34172891-34172913 TCAAATATGCATTTGTTTCAGGG - Intergenic
1174360599 20:50026792-50026814 TGGAACATTCAGTTGTAGCATGG - Intergenic
1174883256 20:54303991-54304013 TCCACCAGGCAGTTCCTGCACGG + Intergenic
1175713626 20:61240706-61240728 TCCACCATGCCGTTGATGCCGGG - Intergenic
1178624586 21:34204242-34204264 ACCAACAAGCATTTATTGCAGGG + Intergenic
1179041003 21:37802204-37802226 AGCAAGAAGCAGTTGTTGCAGGG + Intronic
1180942894 22:19671307-19671329 TCCAAGATTCAGTGGTTCCAAGG + Intergenic
950687928 3:14632209-14632231 TTCAACGTGCAGTTCTTACAAGG - Intergenic
951622998 3:24626467-24626489 TCCAACATGCCTTACTTGCAGGG + Intergenic
952022913 3:29044306-29044328 TGCAACATGGATTTGTTGGAAGG + Intergenic
953046369 3:39297082-39297104 TCCAAGAAGCAGTGGTTCCAGGG - Intergenic
955505921 3:59633057-59633079 TCCAACCTGCAATTGTAGCTTGG + Intergenic
956013724 3:64859010-64859032 TTCAAGATTCAGTTCTTGCATGG + Intergenic
956171591 3:66437693-66437715 TGCTACATGCAGCTGCTGCAAGG + Intronic
961703591 3:128766101-128766123 TCCAACATACAAATTTTGCAGGG + Intronic
963851712 3:150216381-150216403 TCCACAAGGCAGGTGTTGCATGG - Intergenic
965026048 3:163303321-163303343 TGCAACATGCTGCTGTTGCTGGG - Intergenic
967681543 3:192369718-192369740 TCCAACATGCACTAGGTGCTGGG + Intronic
967851736 3:194087768-194087790 ACAAACATTCAGTTGTTGAATGG - Intergenic
968580845 4:1393973-1393995 GCCGACACGCAGTTGATGCATGG + Exonic
969464247 4:7345371-7345393 TCCTTCATGCTGTTGTTGGAAGG + Intronic
969664297 4:8548224-8548246 TCCCACAGGCAGTGGTTGCCGGG + Intergenic
971336293 4:25726904-25726926 TCCAAGATGAAGGTGTTGCCAGG + Intergenic
971549443 4:27931497-27931519 TACAAAATGAAATTGTTGCATGG + Intergenic
972577765 4:40367748-40367770 TCCAAAATGAAGTTGTTGGGAGG + Intergenic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
978931510 4:114318990-114319012 TTCAAAAGGCAGCTGTTGCATGG - Intergenic
980974037 4:139593784-139593806 TTCAACATACAGTTCCTGCAAGG + Intronic
981347842 4:143697388-143697410 TTCAACATGGAGATGTTGTAAGG + Exonic
982637816 4:157919227-157919249 TCCAACATCCACTAGTTGAATGG + Intergenic
982979691 4:162116797-162116819 TCCATTATGGAGTTGTGGCAGGG - Intronic
983117291 4:163834065-163834087 TGCAACATGGTTTTGTTGCAAGG + Intronic
984378956 4:178965913-178965935 TTCAACATGCAAGTGTTGGAGGG - Intergenic
984840388 4:184062203-184062225 TGCAACATGGAGCTGTTTCAAGG - Intergenic
985002283 4:185497568-185497590 CCCAACAGGCAGAGGTTGCAGGG + Intergenic
990682020 5:58255409-58255431 TCCCAAATGCAGTTGTGGAAAGG + Intergenic
993295953 5:86140890-86140912 TCCAACCTGCTTTTGTTGCTAGG - Intergenic
995331898 5:110956028-110956050 TCCAATATGTATTTGTTGAATGG + Intergenic
996779536 5:127170943-127170965 TCCAACATGCAGTTGTTGCAGGG - Intergenic
999872648 5:155768368-155768390 CTCAACAGGCATTTGTTGCATGG - Intergenic
1004301596 6:14463366-14463388 ACCATCATGCAGCTGTTGCAAGG - Intergenic
1007527687 6:42511193-42511215 TCCAGCAGGCAGAGGTTGCAGGG - Intergenic
1008235517 6:49042900-49042922 TCTAATATGCAATTATTGCAAGG - Intergenic
1009774289 6:68185395-68185417 TCCACCATGCTATTTTTGCAAGG + Intergenic
1012529082 6:100212803-100212825 TTCAACTTGTAGTTATTGCAAGG - Intergenic
1012741749 6:103025175-103025197 GCCAACATTTGGTTGTTGCAGGG - Intergenic
1012914839 6:105158304-105158326 TTCACAATGCAGTTGTTGAAAGG + Exonic
1018543806 6:164913656-164913678 TCCACCATGCAGTTGCGGAAAGG - Intergenic
1020903612 7:14037673-14037695 TCCAACATCAAGTTGTTGGCGGG - Intergenic
1022594005 7:31694553-31694575 TTCAACATCCATTTATTGCAGGG + Intronic
1023408283 7:39859875-39859897 TGCAAGATGCAGTTCTTTCATGG + Intergenic
1024881406 7:54089616-54089638 TTCAACATGTAGGTCTTGCAAGG - Intergenic
1025137578 7:56432658-56432680 TGCAAGATGCAGTTCTTTCATGG - Intergenic
1027537332 7:79420178-79420200 TTCATAATGCAGTTGTTGAAAGG - Intronic
1033156875 7:138964456-138964478 TACCTCATGCAATTGTTGCACGG + Intronic
1033518537 7:142135094-142135116 TTCAACTTGCAGTTCTTGCATGG - Intronic
1033546532 7:142406202-142406224 TCCATCATGCAATTGTTACCTGG + Intergenic
1038401659 8:27288594-27288616 TCCAAAATCCAGATGTTGGAAGG - Intronic
1038980940 8:32758943-32758965 TCCAACATTCATTTGTTTCATGG - Intronic
1040951886 8:52945626-52945648 TCCAAGATGCAGTTTTTTTAAGG - Intergenic
1041316259 8:56565477-56565499 TGCAGCTTGCAGGTGTTGCATGG + Intergenic
1047897823 8:129386063-129386085 TTCAATATGCAGTAGTGGCAGGG + Intergenic
1051427095 9:16943231-16943253 TCCACCTTGCAATTGTTGTAAGG + Intergenic
1058774937 9:108273661-108273683 TCCAAGAGGCAGATGTTGAATGG + Intergenic
1058815042 9:108675263-108675285 TCCAGCAGACAGTTGTTGAAGGG + Intergenic
1059209362 9:112498055-112498077 GCCAACATATATTTGTTGCAGGG + Intronic
1059755625 9:117290863-117290885 GCCACCATGCAGTTGTTGCAAGG + Intronic
1061671951 9:132193832-132193854 TCCAAGATGAAGTTGTTGGCAGG + Intronic
1185712827 X:2317819-2317841 TCAAACATGCATTTGTCTCAGGG + Intronic
1187832348 X:23395172-23395194 CCCTACATGCATTTTTTGCATGG + Exonic
1188924869 X:36027230-36027252 TCTTACATGCATATGTTGCATGG + Intergenic
1189003581 X:36971730-36971752 TCCAACAAGCAGTTGGTTGAAGG - Intergenic
1190185392 X:48229264-48229286 TCCAAAAGGCAGAGGTTGCAGGG - Intronic
1196068814 X:111496359-111496381 TCCAACACACAGTTGTTGGGAGG + Intergenic