ID: 996788955

View in Genome Browser
Species Human (GRCh38)
Location 5:127271600-127271622
Sequence GACCCAGTGGGTGGTCATGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996788942_996788955 3 Left 996788942 5:127271574-127271596 CCATAATCCCCATGTGTCATGGG 0: 402
1: 1210
2: 2456
3: 3865
4: 4759
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data
996788946_996788955 -4 Left 996788946 5:127271581-127271603 CCCCATGTGTCATGGGAGGGACC 0: 377
1: 986
2: 2063
3: 3141
4: 3853
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data
996788947_996788955 -5 Left 996788947 5:127271582-127271604 CCCATGTGTCATGGGAGGGACCC 0: 307
1: 989
2: 2673
3: 5073
4: 6735
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data
996788940_996788955 4 Left 996788940 5:127271573-127271595 CCCATAATCCCCATGTGTCATGG 0: 418
1: 1219
2: 2434
3: 3877
4: 4839
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data
996788939_996788955 30 Left 996788939 5:127271547-127271569 CCAAAATCTCATCTTGAATTGTA 0: 6802
1: 10434
2: 9513
3: 7783
4: 4679
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data
996788948_996788955 -6 Left 996788948 5:127271583-127271605 CCATGTGTCATGGGAGGGACCCA 0: 248
1: 720
2: 2044
3: 3588
4: 5801
Right 996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996788955 Original CRISPR GACCCAGTGGGTGGTCATGG GGG Intergenic
No off target data available for this crispr