ID: 996792448

View in Genome Browser
Species Human (GRCh38)
Location 5:127307293-127307315
Sequence GCTCCCTAGTCAAGTTCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 78
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996792448_996792460 18 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792460 5:127307334-127307356 GCTGTTGGGGTGCAGCTGAGTGG 0: 1
1: 0
2: 3
3: 34
4: 286
996792448_996792457 4 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792457 5:127307320-127307342 GGGGCCATGTCTGGGCTGTTGGG 0: 1
1: 0
2: 0
3: 39
4: 220
996792448_996792463 29 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792463 5:127307345-127307367 GCAGCTGAGTGGTGAGAATGGGG 0: 1
1: 0
2: 4
3: 31
4: 351
996792448_996792456 3 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792456 5:127307319-127307341 TGGGGCCATGTCTGGGCTGTTGG No data
996792448_996792458 5 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792458 5:127307321-127307343 GGGCCATGTCTGGGCTGTTGGGG 0: 1
1: 0
2: 1
3: 36
4: 252
996792448_996792462 28 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792462 5:127307344-127307366 TGCAGCTGAGTGGTGAGAATGGG 0: 1
1: 0
2: 2
3: 52
4: 652
996792448_996792454 -4 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792454 5:127307312-127307334 GAGCCTCTGGGGCCATGTCTGGG 0: 1
1: 0
2: 1
3: 27
4: 233
996792448_996792461 27 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792461 5:127307343-127307365 GTGCAGCTGAGTGGTGAGAATGG 0: 1
1: 0
2: 1
3: 31
4: 362
996792448_996792453 -5 Left 996792448 5:127307293-127307315 CCCTGTGAACTTGACTAGGGAGC 0: 1
1: 0
2: 0
3: 4
4: 73
Right 996792453 5:127307311-127307333 GGAGCCTCTGGGGCCATGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996792448 Original CRISPR GCTCCCTAGTCAAGTTCACA GGG (reversed) Intronic
900998205 1:6134200-6134222 GCTCCCTGGTCAAGTCTTCAGGG - Exonic
901201131 1:7468011-7468033 TCTCCCTAGGCAAGCTCACCAGG - Intronic
902497690 1:16885556-16885578 GCTCACAAGTCAAGCTCTCAAGG + Intronic
902604001 1:17558778-17558800 GCTCCTCAGTGAGGTTCACAGGG - Intronic
904976031 1:34457344-34457366 GCTCACTAGTCAAATAAACATGG + Intergenic
908315436 1:62927833-62927855 GCTCCCTAGGAAAGGACACAAGG - Intergenic
911277684 1:95881301-95881323 GCTTCCTAGACAAGTCCACCTGG + Intergenic
911577094 1:99590729-99590751 GCTGCCTGGTTCAGTTCACAGGG - Intergenic
915521165 1:156445102-156445124 GCACCCTACTGAGGTTCACAGGG + Intergenic
916019376 1:160778737-160778759 GCTCTCTGGTCAGGTCCACATGG - Intergenic
922414650 1:225410127-225410149 GCTCCCTCGTCAGCTTCACATGG + Intronic
923394366 1:233546077-233546099 GTTCCCTATTCAAGTTCCAAAGG - Intergenic
924388506 1:243524412-243524434 GCTCCCTAGTGAAGTCTAAAAGG + Intronic
1068086949 10:52385678-52385700 GCAATTTAGTCAAGTTCACATGG - Intergenic
1080697959 11:34619546-34619568 GGGCCCTTGGCAAGTTCACAGGG + Intergenic
1107671967 13:42755298-42755320 GTTCACTACTCAAGTTCACTTGG + Intergenic
1109821397 13:67660659-67660681 TCTCCCAAGCCAAGTTCAAAAGG + Intergenic
1116210827 14:41941175-41941197 ACTCCCTAGTGAAGTTCTCTTGG + Intergenic
1116779856 14:49225076-49225098 GCTTCCCAGTCAAATCCACAAGG + Intergenic
1116855876 14:49951993-49952015 GCTCCCTGGTGAAGTTAAGAGGG - Intergenic
1121689196 14:95863722-95863744 GATCCCTTTCCAAGTTCACACGG - Intergenic
1127603596 15:60563436-60563458 GTTCCCTAATTAAATTCACAAGG - Intronic
1137791113 16:51175606-51175628 GCTCCCTTGTCGAGTTATCAAGG + Intergenic
1142064021 16:88050039-88050061 GCTTCTCAGTCACGTTCACAGGG + Intronic
1151542384 17:74771186-74771208 GTTCCCGGGTCAAGTTCCCAGGG + Exonic
1151696229 17:75719381-75719403 GCCCCCTAGTCATTTTCAGAAGG + Intergenic
1161451202 19:4346381-4346403 GGTCCTTGGTCAAGTTCACCCGG - Intronic
1162380991 19:10331882-10331904 GCTCCCCAGTCAGGTACCCATGG - Intronic
1163377207 19:16940663-16940685 ACTTCCTAGTAAAGTTCCCAGGG + Intronic
931191561 2:60005626-60005648 GCACCCTAGTCATTTTAACATGG + Intergenic
933973475 2:87489273-87489295 GCTCCATGGAGAAGTTCACAGGG + Intergenic
936320250 2:111460940-111460962 GCTCCATGGAGAAGTTCACAGGG - Intergenic
938793977 2:134703088-134703110 GCTCCCTAGGTAAGGTCACATGG - Intronic
945325475 2:208477288-208477310 CCTTCCTAGCCAAGTTCTCAGGG - Intronic
1172918993 20:38465691-38465713 CCTCCCTAGTCAAGCTTTCAGGG - Intergenic
1176451999 21:6871377-6871399 GCTCAGAAGTCAAGTTTACAAGG - Intergenic
1176830171 21:13736426-13736448 GCTCAGAAGTCAAGTTTACAAGG - Intergenic
1181402102 22:22656150-22656172 GCTCCATAGTCTAGTGCAGATGG - Intergenic
1181990727 22:26834845-26834867 GCTTCCTAGTCAAGGACAGAGGG + Intergenic
953075873 3:39569841-39569863 GTTACCTTGTCAAGTTCACCAGG + Intergenic
956244654 3:67168886-67168908 CCTCCCTAGTCCAGGTCACCTGG + Intergenic
960557459 3:119045232-119045254 GCTCCCTAGTGAAGTGAACCCGG - Intronic
968765314 4:2465308-2465330 CCACCCTAGTCATGCTCACATGG - Intronic
969902652 4:10364130-10364152 GCTCCCAAGTCAAATGCATAGGG + Intergenic
970436837 4:16043854-16043876 GGTCCATACTGAAGTTCACAGGG - Intronic
972551322 4:40137678-40137700 GCTTGCTACCCAAGTTCACATGG + Intronic
976073805 4:81273514-81273536 GCTCCCAAGTCAAGTAGTCAAGG - Intergenic
979532708 4:121785963-121785985 GCTACCTACTCCAGTCCACAGGG + Intergenic
983830231 4:172317843-172317865 GGTACTTAATCAAGTTCACAAGG - Intronic
988500588 5:31780342-31780364 GTTCCAAAGTTAAGTTCACAAGG + Intronic
989039672 5:37214725-37214747 TCTCTCTAGTAAAGTGCACATGG + Intronic
992661997 5:78971114-78971136 GCTTACTAGACAAGTTCAAAAGG + Intronic
996097068 5:119410314-119410336 GCTCTCTATTCAAATACACAAGG + Intergenic
996792448 5:127307293-127307315 GCTCCCTAGTCAAGTTCACAGGG - Intronic
997402095 5:133611602-133611624 GCTCCCTAGACACGTTCAAGCGG + Intronic
998489600 5:142534799-142534821 GTACCCTATTCAAGGTCACAAGG - Intergenic
999480540 5:151944166-151944188 GCCCCCTAGTCTAGGTCACCAGG + Intergenic
1007990517 6:46250651-46250673 TCTCTCTAGTCAGGGTCACAAGG - Intronic
1008974292 6:57406496-57406518 ACTGCCTACTTAAGTTCACAGGG - Intronic
1009163179 6:60308010-60308032 ACTGCCTACTTAAGTTCACAGGG - Intergenic
1014066631 6:117134629-117134651 GCATCCTACTCAAATTCACATGG + Intergenic
1018913618 6:168118993-168119015 GCTCCCCAGACACGTTCCCATGG - Intergenic
1028639187 7:93024076-93024098 GCTCCCTAGACAAGGTGAAATGG - Intergenic
1028905747 7:96152314-96152336 GCTCCCTAGGCATCTTCCCAAGG - Intronic
1033394618 7:140961748-140961770 GCTCCCTAATCAACTAGACATGG - Intergenic
1033525362 7:142208158-142208180 GCTCCCAAGTCAGGTAGACATGG - Intronic
1035613841 8:988028-988050 CCTCCCCAGTCAGGTGCACATGG - Intergenic
1040456882 8:47606954-47606976 GCTCCCTCGTCAACAACACAGGG + Intronic
1042972921 8:74430662-74430684 GCTCAGAAGTCAAGTTTACAAGG - Intronic
1056971929 9:91212210-91212232 TCCCCCAAGTCAAGCTCACAGGG - Intergenic
1061163671 9:128910350-128910372 CATCCCTAGTGAAGTTCACAGGG - Intronic
1061619986 9:131805720-131805742 GCTTCCTAGTCAACCTCTCAAGG + Intergenic
1203517182 Un_GL000213v1:13138-13160 GCTCAGAAGTCAAGTTTACAAGG + Intergenic
1186776423 X:12869167-12869189 GCTTCCTACTCAAGTACAAAGGG + Intronic
1189129117 X:38480064-38480086 GCGCCCTACTCAAGATCACAAGG - Intronic
1197459678 X:126724501-126724523 GCTCCCTTATCAACCTCACAGGG - Intergenic
1198662082 X:138980467-138980489 TCTCCCTAATCAAGTCCTCATGG - Intronic
1201409955 Y:13689752-13689774 CCTCCCTAGTAGTGTTCACATGG + Intergenic