ID: 996793846

View in Genome Browser
Species Human (GRCh38)
Location 5:127322475-127322497
Sequence AAGCACTTACAACCAGTGAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 154}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996793846 Original CRISPR AAGCACTTACAACCAGTGAA TGG (reversed) Intronic
901011499 1:6205272-6205294 AAGAGCTCACAACCAGCGAAAGG + Intronic
903246123 1:22016769-22016791 AAGCCCTCTCAACCACTGAATGG - Intergenic
905486445 1:38300333-38300355 AAGGACTTACCAGCAGTGAATGG - Intergenic
907069536 1:51521202-51521224 AAGGGCATACAACTAGTGAATGG - Intergenic
910404751 1:86875328-86875350 AAGCACTTGAAAACAGAGAAGGG + Intronic
911178837 1:94843331-94843353 AAGAACTCACAACAAATGAACGG - Intronic
912100986 1:106204475-106204497 AAGGATTTACTAACAGTGAAAGG + Intergenic
913313959 1:117534380-117534402 AAGGCCTTACAACCAGTCAGGGG - Intergenic
914239211 1:145840451-145840473 AATCACTTAAACCCAGTGAGTGG + Intronic
916863510 1:168831893-168831915 CAGCACTTACAAACAGTGTCTGG + Intergenic
917238780 1:172923635-172923657 AAGGACATAGAGCCAGTGAATGG + Intergenic
924868099 1:248008143-248008165 TAGCACTTACAACCAGAGCCTGG + Intronic
1064331835 10:14401475-14401497 AAATACTTACAAACACTGAAAGG + Intronic
1066388007 10:34957065-34957087 ACCCACTTACACCCAGGGAAAGG + Intergenic
1070592357 10:77810196-77810218 AGGCACTTACAATCAAGGAAGGG + Intronic
1070923582 10:80204352-80204374 AAGCAATGAGAGCCAGTGAAGGG + Intronic
1071089044 10:81897797-81897819 CAGCACTGAAAACCAGTGATGGG + Intronic
1071345921 10:84692784-84692806 TAGCACTAACAACCACTGGATGG + Intergenic
1071955925 10:90759353-90759375 AAGAATTTAAAACCAGGGAAAGG + Intronic
1072241241 10:93497183-93497205 AAGCGCTTCCATCCAGTAAATGG - Intronic
1073422594 10:103436569-103436591 AACCACTCACAACCACTGCACGG + Intronic
1075088252 10:119428476-119428498 AAGGCCTTACATCCAGTGGAGGG - Intronic
1078026989 11:7705424-7705446 AAGCACTTAGAAACACTGGATGG + Intronic
1078408253 11:11089912-11089934 AAGAACTGCCAACCAGTGACTGG - Intergenic
1080761981 11:35259756-35259778 AAGCACATAAAACCAGTTATAGG - Exonic
1080819742 11:35793967-35793989 AAGCACTTACAATTAATAAATGG - Intronic
1083378128 11:62242719-62242741 AAGCGCTAACTACCAGTGATAGG - Intronic
1087215537 11:95489158-95489180 AAGGTCATACAACCAGTAAATGG + Intergenic
1087958904 11:104323829-104323851 AATCATTTATAACCAATGAATGG - Intergenic
1089237654 11:117046057-117046079 CTGCACTTACCACCAATGAATGG - Intronic
1091994620 12:4983454-4983476 AAGTAGTGACAACCAGGGAAAGG + Intergenic
1093321190 12:17717759-17717781 AAGCATTTACAAGTAGTCAAAGG + Intergenic
1094068601 12:26388045-26388067 AACCACTTGGAATCAGTGAAAGG + Intronic
1096048064 12:48581747-48581769 CAGCAATTACAACCTGAGAAGGG + Intergenic
1096056011 12:48652666-48652688 AAGCATTTACATTCAGAGAATGG - Intergenic
1096917794 12:55051924-55051946 AAGGTCATACAACCAGTAAAGGG - Intergenic
1097378829 12:58870493-58870515 CAGCACATACACCCAGTAAAAGG + Intergenic
1100703821 12:97178649-97178671 AATCACTAACAACCACTGAAAGG - Intergenic
1101136087 12:101744472-101744494 AAGGTCTTACAACCAGTTAGAGG - Intergenic
1102418314 12:112783744-112783766 AAGCTCACACAACCAGTGAGTGG + Intronic
1106022377 13:25927610-25927632 AAGAACTAATAACCAGTGAGTGG - Intronic
1106696916 13:32184294-32184316 AAGCATCTCAAACCAGTGAAAGG - Intronic
1107480247 13:40780187-40780209 AGGCAGATACAACCATTGAAAGG - Intergenic
1107965444 13:45593600-45593622 AAGCTCATGCAACTAGTGAAAGG + Intronic
1108544664 13:51480821-51480843 AAGATCTTACAATCAGTAAATGG - Intergenic
1110051967 13:70913592-70913614 AAGCAACTACAACCAGTGTGCGG + Intergenic
1112625910 13:101103441-101103463 TGGCACGTACAACCAGTGAGTGG - Intronic
1112685086 13:101815510-101815532 AAGCACTGAAAACAAGAGAAGGG + Intronic
1114711687 14:24784997-24785019 AAGAAGTTAAAAACAGTGAATGG + Intergenic
1114847625 14:26343102-26343124 AAGCAGATGCAACCCGTGAAGGG + Intergenic
1117406998 14:55413600-55413622 AAGCACTTAGAACCAATGGAGGG - Exonic
1117481421 14:56149001-56149023 AAGCTCTTTCAATCAGTGAATGG - Intronic
1117877181 14:60265285-60265307 AGGCTCTTCCAACCAATGAAAGG - Intronic
1118107641 14:62678337-62678359 AAGCTGTTACTTCCAGTGAAGGG - Intergenic
1120351657 14:83368406-83368428 AGTAACTTTCAACCAGTGAAAGG - Intergenic
1121691844 14:95883743-95883765 TTGCACTTGAAACCAGTGAAGGG - Intergenic
1123147965 14:106152374-106152396 AAGCACTTACACACTGTTAATGG + Intergenic
1124628378 15:31323527-31323549 AAAGACATACAACCTGTGAAGGG - Intergenic
1125552441 15:40556105-40556127 AAGAACATACAACCAGTAAGTGG + Intronic
1126679097 15:51186871-51186893 AAGAACTCACACCCAGGGAATGG - Intergenic
1127851773 15:62919662-62919684 AAGCTCTTACAGCTAGTAAAAGG + Intergenic
1128259529 15:66223088-66223110 AATCTCTAACAACCAATGAATGG + Intronic
1128424949 15:67532418-67532440 ATGTACATACAACCACTGAATGG + Intergenic
1128972012 15:72117013-72117035 AAGCCCTTTCAACCAAAGAAAGG + Intronic
1135073844 16:19376248-19376270 GAGCACCAAGAACCAGTGAATGG + Intergenic
1139306245 16:65988642-65988664 AAACACTGACAAGCAGTAAAGGG - Intergenic
1139386497 16:66575790-66575812 AAGCACTGCCATCCAGTGTATGG - Intronic
1139825443 16:69753705-69753727 AAACACTTCCAACCACTGAGGGG + Intronic
1140874290 16:79136620-79136642 ATGCACTGACCACCAGTGAAGGG - Intronic
1146659879 17:34658686-34658708 AAGCACATACAAACACTGAGTGG + Intergenic
1146722211 17:35131501-35131523 GAGAACTTTCAAGCAGTGAAAGG - Exonic
1149003313 17:51779078-51779100 AAGCCCTCAGAACCAGAGAAGGG + Intronic
1151223801 17:72633661-72633683 AAGAACCAAAAACCAGTGAATGG - Intergenic
1154102637 18:11490097-11490119 CAGCACATAGAACCAGTGAAAGG + Intergenic
1155604092 18:27583634-27583656 AAGGTCATACAGCCAGTGAATGG - Intergenic
1156365923 18:36426934-36426956 AAGCACACACAACCAGGGAGTGG + Intronic
1157686769 18:49649071-49649093 AAGCACTGACACCCTGGGAATGG + Intergenic
1158220382 18:55144455-55144477 AAGCTGATGCAACCAGTGAAGGG - Intergenic
1158311245 18:56161132-56161154 AAGATCTTATAACAAGTGAAAGG + Intergenic
1159006476 18:63017382-63017404 AAGCCCTCACAAGCTGTGAAGGG - Intergenic
1159619807 18:70623895-70623917 TAACACTTACACCCAGTAAATGG - Intergenic
1160781475 19:879512-879534 AGGCATTGACAACCAGGGAAAGG - Intronic
1161782793 19:6304556-6304578 AAGCACTTCCAGCCATTGATAGG - Intergenic
1164599676 19:29552478-29552500 AAGCACCTACCACCAGCCAAGGG + Intronic
925562442 2:5211506-5211528 AAGCAGAGACAACCAGAGAAGGG + Intergenic
926693578 2:15754555-15754577 AGGGACTTACAACCAGGGGAAGG + Intergenic
927607871 2:24504608-24504630 AAGAACTTACAAGCACTGAATGG + Intronic
927955669 2:27205768-27205790 AAGAACATACTACCAGTGAGGGG + Intronic
928006554 2:27567567-27567589 AAGCAGTTACAACCTGGGGATGG + Intergenic
929395624 2:41518865-41518887 CAGCACTAACAGCAAGTGAAGGG + Intergenic
931199105 2:60079861-60079883 AATCACTGACACACAGTGAAAGG + Intergenic
931810945 2:65854327-65854349 AAGCACATATACCCAGGGAAGGG - Intergenic
935320405 2:101882433-101882455 CAGCACTTAAACCTAGTGAAAGG - Intronic
935456884 2:103280355-103280377 AAACCCTAACAACCACTGAAAGG - Intergenic
937658341 2:124402303-124402325 AAGCACTAATACCCACTGAAGGG + Intronic
939165916 2:138641148-138641170 AATCACTTGCAACATGTGAAAGG + Intergenic
939835695 2:147126428-147126450 AAGCACTTACTAGAAGAGAAAGG - Intergenic
944948429 2:204717839-204717861 AGTCACTGACAACCAGGGAAGGG + Intronic
945508726 2:210673971-210673993 AAGCTCATACCACTAGTGAATGG + Intronic
946178281 2:217935224-217935246 AATCACTTTCCAACAGTGAAGGG + Intronic
947019696 2:225661602-225661624 AAGGTCTTATAACCAGTGAGTGG + Intergenic
1170196666 20:13695883-13695905 AATCACTTATTACTAGTGAATGG + Intergenic
1170562862 20:17571635-17571657 AAGCACTTTCACAGAGTGAATGG - Intronic
1178057685 21:28817826-28817848 AAGGACATACAGCTAGTGAATGG - Intergenic
1178746058 21:35251364-35251386 CACCATTTACAACCACTGAACGG + Intronic
1179093971 21:38294886-38294908 AAGTTCTTACAACTATTGAATGG - Intronic
1185122025 22:48977036-48977058 AAGCACATACACCCAGGGCAGGG + Intergenic
957312695 3:78540996-78541018 TAGCACTTACCACAGGTGAAGGG - Intergenic
958886318 3:99731656-99731678 AGGCAATTGCAACCACTGAAGGG + Intronic
960486831 3:118263118-118263140 AAGCACTTACTGACAGAGAAGGG - Intergenic
961704224 3:128772072-128772094 AAGCAGTTACAACCAGTTCAGGG + Intronic
964848315 3:161067680-161067702 AAGCACACACAGCTAGTGAATGG + Intronic
965726161 3:171718710-171718732 AAGTTCTTACAAGCAGTGAGTGG - Intronic
969283929 4:6190746-6190768 AAGCACACACACCCAGTGACAGG + Intronic
972509569 4:39755230-39755252 AAGTAAGTAAAACCAGTGAATGG - Intronic
973797383 4:54441940-54441962 AAGGACATGCAGCCAGTGAAGGG - Intergenic
974980023 4:68943992-68944014 AAGCACATTCAACCAATGAATGG - Intronic
980873971 4:138641953-138641975 AAGCACTAACAAAGAATGAAGGG - Intergenic
982704344 4:158691129-158691151 AAGATGTTACAACCAGTGCAAGG + Intronic
985654205 5:1121608-1121630 AAGGGCTTACAGCCAGTGAGTGG + Intergenic
987374735 5:17223222-17223244 AAGATCATACAACCAGTAAATGG - Intronic
988392239 5:30649733-30649755 AATGTCTAACAACCAGTGAATGG + Intergenic
989735622 5:44701061-44701083 AAGCAGTGACAAACAGTCAATGG + Intergenic
990218513 5:53561177-53561199 AACCACTTAAAACCATGGAAGGG - Intronic
994952119 5:106476924-106476946 AAGCATTTAAAACCCTTGAAAGG + Intergenic
995604708 5:113840142-113840164 CACCACTTAAAACCAATGAAGGG + Intergenic
996107709 5:119524528-119524550 AAGCACTTACCAGCACTGAAAGG - Intronic
996793846 5:127322475-127322497 AAGCACTTACAACCAGTGAATGG - Intronic
997992186 5:138553701-138553723 AAGTACTTACAATCACTAAAGGG + Intergenic
998024883 5:138807456-138807478 AAGCACTAACAACTAGTTTAGGG - Intronic
1004149833 6:13105722-13105744 AAGCACTTACACCTAATTAAAGG + Intronic
1013395964 6:109740013-109740035 AATCACTTTCAACCAGTGAGTGG + Intronic
1016473961 6:144406142-144406164 AAGCTGTTACAACCAGTTCAGGG - Intronic
1017097562 6:150818030-150818052 AAGCATTTACACACAGTGCAGGG - Intronic
1017403247 6:154088843-154088865 AAGCACATTCTACCAGGGAATGG - Intronic
1017604080 6:156114597-156114619 AAACACTGACATTCAGTGAAAGG + Intergenic
1017939271 6:159036817-159036839 AAACACTAACAAAGAGTGAAGGG - Exonic
1021085800 7:16420528-16420550 AAGCCCTTTCCACCATTGAAAGG + Intronic
1023464688 7:40441006-40441028 AAGTAATTACAAACAGTGACAGG - Intronic
1023475377 7:40572413-40572435 AAGCTCTGACCACCAATGAATGG - Intronic
1030295235 7:107918763-107918785 AAGCACAAAGAACCAATGAATGG + Intronic
1031123806 7:117750369-117750391 AAGGGCTTACATCTAGTGAATGG - Intronic
1033295748 7:140133078-140133100 AAGCACACACAACCACTGCAGGG - Intronic
1034858187 7:154573478-154573500 ATGCACTTCCAGGCAGTGAAGGG - Intronic
1037714093 8:21382295-21382317 AATCACATACAACCAAAGAAAGG + Intergenic
1040410210 8:47146545-47146567 AAGCACTTGAAACCAGTACATGG + Intergenic
1044601935 8:94013784-94013806 AAGCACTTACATGCATAGAAAGG + Intergenic
1045186784 8:99846154-99846176 CAGTACTTACAACCAGTGCCGGG - Intronic
1045290914 8:100831903-100831925 AAGCACCCCCAACCACTGAATGG - Intergenic
1046504185 8:115115839-115115861 AAGCAGTGACACCCAGTGGATGG + Intergenic
1046563335 8:115867291-115867313 GAGCCCTTACAACCAGTTACTGG + Intergenic
1047441517 8:124883118-124883140 AAGCTCATACAACCAATAAATGG - Intergenic
1050085749 9:1963997-1964019 GAGCACTTACCACCAGCAAATGG + Intergenic
1051575923 9:18615371-18615393 AAGCACATATAGCAAGTGAAGGG - Intronic
1053193941 9:36100198-36100220 AAGCACATACAACCCATGAAAGG - Intronic
1057326043 9:94065131-94065153 TGGCACTTACAACTAATGAAAGG - Intronic
1058770338 9:108224958-108224980 AAGCCCTTAAACCTAGTGAAAGG + Intergenic
1059779687 9:117513385-117513407 AACCACTGACAACCTATGAATGG - Intergenic
1061767969 9:132894333-132894355 AAGCACTTAAAACCAGTTTCAGG + Exonic
1062043328 9:134414162-134414184 AAGCACTTTGAAGCTGTGAAGGG - Intronic
1186110384 X:6248868-6248890 ATTCACTTATAATCAGTGAATGG + Intergenic
1187197812 X:17104879-17104901 AAGAAATTACAGCCAATGAAAGG - Intronic
1187444958 X:19352897-19352919 AAGCACATGGAACTAGTGAAAGG + Intronic
1188518903 X:31016059-31016081 AAGCACATACATACAGGGAAAGG + Intergenic
1189748526 X:44194953-44194975 CAGCAGATACAACCAGTGCAGGG + Intronic
1190155153 X:47985182-47985204 AAGGTTTTCCAACCAGTGAATGG + Intronic
1199582265 X:149372155-149372177 TGGCACGTACCACCAGTGAAGGG - Intergenic