ID: 996794090

View in Genome Browser
Species Human (GRCh38)
Location 5:127325357-127325379
Sequence CAATACTCATTAAAGATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 178}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996794090_996794091 7 Left 996794090 5:127325357-127325379 CCTTAGATCTTTAATGAGTATTG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 996794091 5:127325387-127325409 ATTTTTTCCCTCATATGTTGTGG 0: 1
1: 0
2: 3
3: 42
4: 461
996794090_996794094 14 Left 996794090 5:127325357-127325379 CCTTAGATCTTTAATGAGTATTG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 996794094 5:127325394-127325416 CCCTCATATGTTGTGGGTGATGG No data
996794090_996794092 8 Left 996794090 5:127325357-127325379 CCTTAGATCTTTAATGAGTATTG 0: 1
1: 0
2: 1
3: 10
4: 178
Right 996794092 5:127325388-127325410 TTTTTTCCCTCATATGTTGTGGG 0: 1
1: 0
2: 5
3: 47
4: 632

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996794090 Original CRISPR CAATACTCATTAAAGATCTA AGG (reversed) Intronic
903081001 1:20813179-20813201 CAGCAGTCATTAAAGCTCTAAGG + Exonic
905715082 1:40142270-40142292 GAATACTCATAAAAGAGATAAGG + Intergenic
905767984 1:40618940-40618962 TAAAAGTCATTAAACATCTAGGG - Intergenic
906000920 1:42424201-42424223 AAATACACATTAAATATCGAGGG + Intergenic
909083923 1:71149472-71149494 AAAAACTAATTAAAGCTCTATGG + Intergenic
909262883 1:73517185-73517207 CAATAATCGTTAAAGATTAAAGG + Intergenic
911946956 1:104123206-104123228 CAATATTCCTTAAAGATCAGAGG - Intergenic
912798808 1:112707955-112707977 CAATATTCATCACAGATCTCTGG + Intronic
916595571 1:166239449-166239471 AAACACTCATCAAAGATATATGG - Intergenic
916602219 1:166304262-166304284 CAATACTCATTCACAATCTCAGG + Intergenic
917180831 1:172296116-172296138 CATTACTCAATAAATATCTATGG + Intronic
917599392 1:176559395-176559417 AAATATTCAGTAAAGATGTAGGG + Intronic
918686306 1:187420050-187420072 GAATACTCAATAAATATTTATGG + Intergenic
923271915 1:232363277-232363299 CAACCCTCATTAAAGTCCTAGGG + Intergenic
923521949 1:234741704-234741726 CGATACTCATAATAGATCCAAGG - Intergenic
923958292 1:239047351-239047373 TAATAATCATTTGAGATCTAGGG + Intergenic
1064821649 10:19342291-19342313 CAATAACCATTTAAAATCTAAGG + Intronic
1065165734 10:22975244-22975266 CATTTCTCCTTAAATATCTATGG + Intronic
1067094348 10:43288836-43288858 CAATACTTCTTAAAGATCTCTGG + Intergenic
1067664169 10:48259400-48259422 CAAGACTAATTAAAGCTATATGG + Intronic
1068976244 10:63013310-63013332 CTTTACTCTTTAAAGATATAGGG + Intergenic
1069143681 10:64861589-64861611 CAAAACCCATTCAAGATCAATGG - Intergenic
1069284885 10:66701258-66701280 CAAAACTCATTATAAAACTATGG - Intronic
1070853399 10:79585637-79585659 CAATACTCAATAAACATTTATGG + Intergenic
1070858440 10:79628763-79628785 CAATGCTCAATAAACATTTATGG - Intergenic
1072052277 10:91717736-91717758 CAAGACTTATTAAAGAACTATGG + Intergenic
1075218734 10:120564350-120564372 CAAAGCTAATCAAAGATCTAAGG - Intronic
1075897578 10:126010525-126010547 AAACACTCATGAAATATCTAAGG - Intergenic
1078958190 11:16227807-16227829 GAATAGTAATTAAAGACCTAGGG - Intronic
1080359919 11:31501082-31501104 CAATAGTCATTAAACACGTATGG - Intronic
1080757144 11:35212691-35212713 CAATGCTGAATAAAGAACTAAGG - Intronic
1081114046 11:39175691-39175713 CAATATTCATTTATGCTCTACGG - Intergenic
1081255021 11:40882090-40882112 CAATACTCATTTATAATCGATGG - Intronic
1081476977 11:43443265-43443287 CAGTACTCATTCAAGACCTTGGG - Intronic
1086114575 11:83234518-83234540 CAATATTCAATAAAAATCTTGGG + Intronic
1086320549 11:85642790-85642812 CAATACTCATGGTAGATATATGG - Intergenic
1086552132 11:88064808-88064830 AAACATTCATTAAATATCTAAGG - Intergenic
1086633680 11:89055316-89055338 CAATACTCACTAAAACTCTTTGG - Intronic
1087400680 11:97663038-97663060 CAATACTTCTTAAATATTTATGG - Intergenic
1089574070 11:119429171-119429193 CAATACTCCTTAAAACTTTATGG - Intergenic
1090071571 11:123548911-123548933 CAATCCTCATTAAAGAGTTTTGG - Intronic
1091098348 11:132845414-132845436 AAATACTCTTTAAAAATCTGTGG + Intronic
1092950359 12:13498093-13498115 CAACACTCAATAAATATCTTTGG - Intergenic
1095268352 12:40186644-40186666 CACTAATCATTAAAAATATATGG + Intergenic
1097755387 12:63401667-63401689 CCATACCCATTAAACATTTAGGG + Intergenic
1098365320 12:69697345-69697367 CTTTACACAGTAAAGATCTAAGG + Intronic
1099289549 12:80759765-80759787 AAATACTCTTTAAAGCTTTAGGG + Intergenic
1101171424 12:102100102-102100124 TAATACACATTAAACATTTACGG - Intronic
1101664680 12:106800978-106801000 CAATACTCATTTAATCTTTAGGG - Intronic
1107160909 13:37226577-37226599 CAAAACTTAGTAAAGATATAGGG - Intergenic
1109182678 13:59232594-59232616 AAAGACTGATTAAAGATCTTGGG + Intergenic
1110024668 13:70520497-70520519 CAAGACTGCTTAAAGATCTTTGG - Intergenic
1110814784 13:79849192-79849214 TAATACTCATTGTAGATGTAAGG - Intergenic
1111346961 13:86970741-86970763 CAATTTTCATCAAAGAACTATGG + Intergenic
1112837523 13:103534012-103534034 CAAGATTTATTAAAGATGTAAGG - Intergenic
1114909750 14:27175708-27175730 AAATATTCATTAAAATTCTAAGG - Intergenic
1115908766 14:38231880-38231902 GAATACCCAGTAAAGATCTGTGG + Intergenic
1116066533 14:39991164-39991186 GAATAATCATTAATGATCCATGG - Intergenic
1117409432 14:55437796-55437818 CAAGACTCACTAAAGACCCATGG + Intronic
1117415610 14:55492487-55492509 AAATACTCTTTAATGATATAGGG + Intergenic
1117786556 14:59291901-59291923 CACTTCCCATTTAAGATCTAGGG + Intronic
1117886956 14:60374272-60374294 AGATACTCATTTTAGATCTATGG + Intergenic
1120631290 14:86894555-86894577 TAACACTCATTAAATATCCATGG + Intergenic
1124699318 15:31898152-31898174 CAATATTCATAACAGATCTTGGG + Intergenic
1125372762 15:38995939-38995961 CAATACTAATTAAAGGTCATTGG + Intergenic
1130092122 15:80829789-80829811 CAATACTCCTTAAAGGTATTTGG - Intronic
1130369554 15:83273158-83273180 TAAAGCTCATTAAACATCTATGG + Intronic
1130827440 15:87564126-87564148 TTATACTCATTAAAAATCAATGG - Intergenic
1131173161 15:90192410-90192432 CAATACCCATTAATCATCCATGG - Intronic
1135485265 16:22859520-22859542 CAAGACTCATAAAAGATGTAAGG - Intronic
1139013137 16:62657930-62657952 CAATACTCAAAAAAGATCCCTGG - Intergenic
1144902380 17:18608583-18608605 GAAAAATCATTAAAGTTCTAGGG - Intergenic
1149338067 17:55658192-55658214 CAATGCTCATTGATGATCTGTGG - Intergenic
1149938954 17:60842356-60842378 TTATAATCATTAAAAATCTAAGG + Intronic
1155175790 18:23299996-23300018 CAATGATGATTACAGATCTAGGG - Intronic
1156050543 18:32928246-32928268 CATTATTCATTAAAGAACTGCGG + Intergenic
1156814473 18:41293221-41293243 CAATACTAATTTAAGTTCTTTGG + Intergenic
1158960265 18:62582351-62582373 CAATTCTCATTTTACATCTAGGG - Intronic
1159137552 18:64354258-64354280 GAGTAATCATTAAAGATCAAGGG + Intergenic
1164817847 19:31219554-31219576 CAATAGCCACTAAAGATGTATGG + Intergenic
926341609 2:11909026-11909048 CAATCCTCATTACAGAGCCATGG - Intergenic
926938724 2:18113414-18113436 CAATTCTCATTAAACATCCAGGG + Intronic
927762005 2:25765857-25765879 AAATATTTATTAAATATCTATGG - Intronic
928996262 2:37294772-37294794 CCATCCTCATTAAAACTCTAAGG + Intronic
929129533 2:38553495-38553517 CCATACTCATTAAAAATAAAAGG + Intergenic
929136203 2:38626086-38626108 CAATCATCATTAAAGATACATGG + Intergenic
929327732 2:40637533-40637555 CAATTTTCTTTAAATATCTATGG - Intergenic
932631806 2:73351071-73351093 CAATATTCTTTAAAGCTCTCTGG - Intergenic
933620135 2:84529410-84529432 TAATACTGATTAAAAATATATGG - Intronic
934706216 2:96483368-96483390 CAATAGCAATTAAATATCTAAGG + Intergenic
935025148 2:99269555-99269577 CCATACTCCTGAAAGCTCTAGGG - Intronic
936417851 2:112335322-112335344 CACTACTCTTTAAAGTTCCATGG - Exonic
937474400 2:122202219-122202241 AAACACTCATGAAAGATCTGGGG - Intergenic
938213224 2:129485970-129485992 GAATACTCATTAAAGACGAAAGG - Intergenic
940803031 2:158154151-158154173 CAATACTCACCATAGATCTAGGG + Intergenic
941369431 2:164645984-164646006 CATTACTCCTTAAAGCTCTGTGG - Intergenic
944992178 2:205250531-205250553 AAGTACTCATTAACAATCTAGGG + Intronic
945211482 2:207387600-207387622 AAATACTCAATAAATATATACGG + Intergenic
946587949 2:221211393-221211415 AGATTCTCATTAAACATCTATGG + Intergenic
947024533 2:225722237-225722259 CCATTCTCATTAAAGTTTTAAGG - Intergenic
1170174353 20:13452261-13452283 CAAAACAAATTGAAGATCTATGG - Intronic
1171327152 20:24304828-24304850 CAATGCTCATTGAAAATATAGGG - Intergenic
1173758417 20:45538657-45538679 TAATCCTCATTACAAATCTATGG + Intronic
1176689789 21:9891646-9891668 CATTTCTAATTAAAGATCTTAGG + Intergenic
1182665681 22:31958006-31958028 CAATAATCACTAAAGATTTCAGG - Intergenic
949161386 3:886971-886993 TAATACTGATTAAAAATCTAAGG + Intergenic
949212266 3:1517332-1517354 TAAAACACATTAATGATCTAAGG - Intergenic
951066593 3:18273736-18273758 GAATACTAATTAAAGATCTCAGG - Intronic
951904641 3:27692514-27692536 CAATATTCATCAAAGATATTGGG - Intergenic
953199014 3:40760729-40760751 CAATATTCATTAGAGATATTTGG - Intergenic
954271275 3:49511459-49511481 ACAAACTCATTTAAGATCTAGGG - Intronic
955145972 3:56319924-56319946 CAAAACTCACTAAAGATACAGGG + Intronic
956332717 3:68129093-68129115 TAATACTCATGACAAATCTAAGG + Intronic
957312092 3:78533836-78533858 TAGTAGTCATTAAAGATCTGTGG - Intergenic
958077777 3:88706055-88706077 CAATTCTCATTACAGAACTTCGG + Intergenic
959238892 3:103762645-103762667 CAAAACTTATTAAACATCCAGGG - Intergenic
959274764 3:104264354-104264376 CAATACTCATTAATGACTTTGGG + Intergenic
959465023 3:106675177-106675199 CAATACTGATTAAGGATGAATGG + Intergenic
959816877 3:110683994-110684016 CAATACTCCTTTAAGAGTTACGG - Intergenic
960606071 3:119506597-119506619 TTATACTCATTAAATATATATGG + Intronic
961611148 3:128140796-128140818 CAATATTCAGTAAAGATGTTGGG + Intronic
963427206 3:145146574-145146596 CAATATTTAATAAATATCTAAGG + Intergenic
965059963 3:163772965-163772987 CAGTACTCATTACAGACCTGGGG - Intergenic
965425125 3:168513520-168513542 AAAAACTCCTTAAAGGTCTAGGG - Intergenic
971184975 4:24366281-24366303 CTTTTCTCATTAAAGATTTAAGG - Intergenic
973890760 4:55365150-55365172 CAATGGTCATTACAGACCTACGG - Intronic
973894034 4:55395023-55395045 CTGTACTCAGTAAAGAGCTAAGG - Intergenic
975976801 4:80106929-80106951 CAATAGTCATTGAAGATTTGGGG + Intronic
976060695 4:81124793-81124815 CAATAATCATTTATGATCTCAGG - Intronic
976955863 4:90898586-90898608 CAAGACAGATTAAAGATTTAAGG - Intronic
977915537 4:102588155-102588177 AAATGCTCATTAAATATCTGTGG + Intronic
979186402 4:117800340-117800362 CAAGACTCATTATAAAGCTATGG + Intergenic
979537195 4:121836592-121836614 GAATACTCATTAATGATTGAAGG - Intronic
981316762 4:143348274-143348296 CATTTCTCATTCCAGATCTATGG + Intronic
982492867 4:156051147-156051169 AAATACTCATTAAACATGTCTGG - Intergenic
983538505 4:168883493-168883515 CAATATTGATTAAAGAGATAAGG - Intronic
983633428 4:169873388-169873410 CAATACTAATTAGAGATGGATGG + Intergenic
986479530 5:8172284-8172306 CAATACTCATCAAATATCACTGG - Intergenic
987170615 5:15253594-15253616 CAATATTCATTAAATATCTATGG + Intergenic
988114220 5:26863390-26863412 AAATACTCATTAAAAGTGTATGG + Intergenic
990061158 5:51650648-51650670 CAATACTCACTACACTTCTATGG - Intergenic
991981869 5:72240498-72240520 TAATACTCATTTTAAATCTAAGG + Intronic
992587558 5:78256732-78256754 CAATATTCATTAGAGATATTGGG - Intronic
994228723 5:97286969-97286991 AAATACTAAGAAAAGATCTAAGG - Intergenic
996794090 5:127325357-127325379 CAATACTCATTAAAGATCTAAGG - Intronic
1000543897 5:162575538-162575560 CAATAATCATTAAATATAAATGG + Intergenic
1004873033 6:19926723-19926745 CAATAATCAATAAAAATATATGG - Intergenic
1006065284 6:31456608-31456630 AAAGACTCATTAAAAATATAAGG - Intergenic
1008828955 6:55734995-55735017 AAATACTTAGTAAAGATCTTGGG - Intergenic
1010225933 6:73489082-73489104 CAATATGTATTAAAGACCTAAGG - Intronic
1010551653 6:77230805-77230827 AAAGAGTCATTAACGATCTATGG - Intergenic
1012077436 6:94708415-94708437 CAATATTAATTAAAGACATATGG - Intergenic
1013567060 6:111376452-111376474 CAGTACTGCTTAAAGATCCAGGG + Exonic
1015156219 6:130099430-130099452 CAGTGCTAATTAAACATCTATGG - Intronic
1015379994 6:132556181-132556203 CAATAATTATTTAAGATCCAGGG + Intergenic
1015389168 6:132661786-132661808 CAATATTTATTAAGCATCTACGG - Intergenic
1015597338 6:134878323-134878345 CAATGCTCATTACAGAAATATGG + Intergenic
1017861689 6:158404284-158404306 CAATACTTATGAAAGGGCTATGG - Intronic
1021438742 7:20653013-20653035 AAAAAATCATTAAAGATTTAAGG + Intronic
1021802003 7:24316604-24316626 AAATACTCATGCAAAATCTAAGG + Intergenic
1028838363 7:95398971-95398993 CAATACTATATATAGATCTAGGG + Intergenic
1029800184 7:102938735-102938757 CAATTCTCATTGAAGTTCTAAGG + Intronic
1030631973 7:111906225-111906247 AAATACTGATTACAGTTCTAGGG + Intronic
1030827556 7:114178790-114178812 CAAAACTAATTAAAGATCCTGGG - Intronic
1031496890 7:122460699-122460721 AAATAATTATAAAAGATCTAAGG + Intronic
1032184131 7:129709029-129709051 CAATACTCATGAAAGACATCTGG - Intronic
1032839531 7:135703203-135703225 TAATCCTCATCACAGATCTATGG + Intronic
1033061537 7:138113780-138113802 CAATACCCATTAATGATCCCCGG - Intronic
1037180268 8:15996458-15996480 TAATAATCATTAAAGATATGTGG + Intergenic
1038707000 8:29903619-29903641 CACCACTTATTAAAGAGCTATGG + Intergenic
1039033433 8:33333529-33333551 CAATACTCTTTGAAGAACCAGGG - Intergenic
1039129047 8:34240450-34240472 CAAAACTCATTAAATACTTATGG + Intergenic
1039371353 8:36986996-36987018 CAATCCTCATGAAAGCTCCATGG + Intergenic
1041231025 8:55752245-55752267 AACTTCTCATTAAAGATCTGAGG + Intronic
1043243584 8:77969266-77969288 CCTTACTCAATAAAGATCTTTGG - Intergenic
1043657525 8:82688555-82688577 AAAGAATCATTAAAGATTTATGG + Intergenic
1043740578 8:83806073-83806095 TAATACTCCTTAATAATCTAGGG - Intergenic
1045833249 8:106490045-106490067 CAGTACTCAATAAAGATTTGTGG - Intronic
1046438420 8:114226632-114226654 CCATACGCATTAAAGATTTTTGG + Intergenic
1050752557 9:8957597-8957619 CAAAACTGATTAAAGATACAAGG - Intronic
1054804190 9:69382126-69382148 CTATGCTCATTAAAGATGGAAGG + Intronic
1055640553 9:78315891-78315913 CAATGCTCAGCTAAGATCTAGGG - Intronic
1055729983 9:79270620-79270642 CTATACTCATTAAAGTTTGAGGG - Intergenic
1057974297 9:99587905-99587927 CAATTCCCATTAAAGAACCAGGG + Intergenic
1059090442 9:111351788-111351810 CAAAACTTACTAAAAATCTATGG - Intergenic
1189236481 X:39490920-39490942 CTATTCCCACTAAAGATCTAGGG + Intergenic
1197138325 X:123088846-123088868 GAAGACTGATTAAAGATCAAAGG - Intergenic
1197174501 X:123470954-123470976 CAAGAATCATTACAGATCGATGG + Intronic
1199790527 X:151151117-151151139 TAGTACTCAGTAAAGACCTAAGG + Intergenic
1201551733 Y:15224514-15224536 AAATTCTTATTAAAGAACTATGG + Intergenic