ID: 996794446

View in Genome Browser
Species Human (GRCh38)
Location 5:127329897-127329919
Sequence ATTACAGGTGTTACACACCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 836
Summary {0: 1, 1: 0, 2: 2, 3: 31, 4: 802}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
996794440_996794446 18 Left 996794440 5:127329856-127329878 CCAGAGGCTGCAGGAGTGCCTGT 0: 1
1: 0
2: 6
3: 38
4: 329
Right 996794446 5:127329897-127329919 ATTACAGGTGTTACACACCCGGG 0: 1
1: 0
2: 2
3: 31
4: 802
996794442_996794446 0 Left 996794442 5:127329874-127329896 CCTGTGATTCTCAGGTGCAAACC 0: 1
1: 0
2: 1
3: 12
4: 188
Right 996794446 5:127329897-127329919 ATTACAGGTGTTACACACCCGGG 0: 1
1: 0
2: 2
3: 31
4: 802

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
996794446 Original CRISPR ATTACAGGTGTTACACACCC GGG Intronic
900037167 1:424254-424276 ATTACAGGTGTGAGCCACCATGG - Intergenic
900058797 1:659995-660017 ATTACAGGTGTGAGCCACCATGG - Intergenic
901301981 1:8206366-8206388 ATTACAGGTGTGAGCCACCATGG + Intergenic
902533688 1:17106714-17106736 ATTACAGGCGTGAGCCACCCTGG + Intronic
902794235 1:18790671-18790693 ATTACAGGTGTAAGCCACCATGG - Intergenic
902825648 1:18972186-18972208 ATTACAGGTGTGAGTCACCATGG - Intergenic
902834082 1:19035599-19035621 ACTGCAGGTGTCACACATCCAGG - Intergenic
902973071 1:20069397-20069419 ATTACAGGTGTGAGCCACCACGG - Intronic
903011636 1:20335033-20335055 ATTACAGGTGTGAGCCACCATGG - Intronic
903207527 1:21793870-21793892 ATTACAGGTGTGAGCCACCATGG + Intergenic
903552490 1:24167656-24167678 ATTACAGGTGTGAGCCACCATGG + Intronic
903660827 1:24977367-24977389 ATTACAGGTGTTTGCCACCACGG - Intergenic
904075375 1:27837801-27837823 ATTACAGGTGTGAGCCACCATGG - Intronic
904146659 1:28398245-28398267 ATTACAGGCGTGAGCCACCCCGG - Intronic
904149373 1:28424759-28424781 ATTACAGGTGTGAGCCACCGTGG + Intronic
904182422 1:28675403-28675425 ATTACAGGAGTGAGCCACCCCGG - Intronic
904761673 1:32809359-32809381 ATTACAGGTGTGAGCCACCATGG + Intronic
905090293 1:35425396-35425418 ATTACAGGTGTGAGCCACCGTGG - Intergenic
905124056 1:35704709-35704731 ATTACAGGTGTGAGCCACCGCGG - Intergenic
905222324 1:36457001-36457023 ATTACAGGTGTGAGCCACCATGG - Intronic
905358569 1:37402437-37402459 ATTACAGGTGTGAGCCACCATGG - Intergenic
905501114 1:38437701-38437723 ATTACTGGTGTGAGACACCATGG + Intergenic
905586008 1:39119043-39119065 ATTACAGGTGTGAGCCACCGTGG - Intronic
906093573 1:43203730-43203752 ATTACAGGTGTGAGCCACCGTGG + Intronic
906259198 1:44373649-44373671 ATTACAGGTGTGAGCCACCATGG - Intergenic
906267872 1:44448023-44448045 ATTACAGGCGTGACACTGCCCGG - Intronic
906385641 1:45366358-45366380 ATTACAGGTGTGAGCCACCACGG + Intronic
907343661 1:53756170-53756192 CTTGGAGCTGTTACACACCCAGG - Intergenic
908337778 1:63145064-63145086 ATTACAGGTGTGAGCCACCGCGG - Intergenic
908460730 1:64346256-64346278 ATTACAGGTGTGAGCCACCATGG + Intergenic
908720695 1:67122308-67122330 ATTACAGGTGTGAGCCACCATGG + Intronic
908802402 1:67893780-67893802 ATTACAGGTGTGAGCCACCGTGG + Intergenic
909952283 1:81734758-81734780 ATTACAGGTGTGAGCCACCATGG - Intronic
910024907 1:82638493-82638515 ATTACAGGTGTGAGCCACCGCGG - Intergenic
910836806 1:91521891-91521913 ATTACAGGTGTGAGTCACCACGG - Intronic
910896559 1:92075989-92076011 ATTACAGGTGTGAACCACCATGG + Intergenic
911111914 1:94198200-94198222 ATTACAGGTGTGAGCCACCGTGG - Intronic
911300392 1:96165809-96165831 ATTACAGGTGTGAGCCACCACGG - Intergenic
911583920 1:99668196-99668218 ATTACAGGTGTCAGCCACCGCGG + Intronic
912339193 1:108894422-108894444 ATTACAGGTGTGAGCCACCATGG - Intronic
912596240 1:110879839-110879861 ATTACAGGTGTGAGCCACCATGG + Intronic
912991372 1:114489975-114489997 ATTACAGGTGTGAGCCACCATGG - Intronic
914694395 1:150062985-150063007 ATTACAGGCGTGACCCACCAAGG + Intergenic
914723074 1:150305310-150305332 ATTACAGGTGTGAGCCACCATGG + Intronic
914729457 1:150357797-150357819 ATTACAGGTGTCAGCCACCGTGG + Intergenic
915319150 1:155046742-155046764 ATTACAGGTGTGAGCCACCACGG + Intronic
915407178 1:155669309-155669331 ATTACAGGTGTGAGCCACCATGG + Intronic
916048601 1:161019320-161019342 ATTACAGGTGTGAGCCACCGCGG - Intronic
916923610 1:169494721-169494743 ATTACAGGTGTGAGCCACCGCGG - Intergenic
917333829 1:173908831-173908853 ATTACAGGCGTGAGCCACCCTGG + Intronic
917493804 1:175521707-175521729 AATAGAGGTGATACAAACCCAGG - Intronic
917565004 1:176204644-176204666 ATTACAGGTGTGAGCCACCGTGG - Intronic
917872262 1:179252461-179252483 ATTACAGGTGTGAGCCACCATGG - Intergenic
918059227 1:181047325-181047347 ATTACAGGTGTGAGCCACCATGG - Intronic
918543767 1:185659587-185659609 ATTACAGGTGTGAGCCACCTTGG + Intergenic
918604760 1:186409815-186409837 ATTACAGGTGTTAGTCACCAAGG + Intronic
918625011 1:186647368-186647390 ATTACAGGTGTGAGCCACCGGGG + Intergenic
919366226 1:196664333-196664355 ATTACAGGTGTGAGCCACCATGG + Intronic
920411938 1:205768806-205768828 ATTACAGGTGTGAGCCACCACGG + Exonic
920523212 1:206644811-206644833 ATTACAGGTGTGAGCCACCACGG + Intronic
921643462 1:217584222-217584244 ATTACAGGTGTGAGCCACCGCGG - Intronic
921780338 1:219155499-219155521 ATTTCAGGTGTAAATCACCCTGG + Intergenic
921973765 1:221178837-221178859 ATTACAGGTATGAGACACCGAGG - Intergenic
922233215 1:223704015-223704037 ATTACAGGTGTGAGCCACCACGG - Intronic
923186413 1:231577797-231577819 ATTACAGGTGTGAGCCACCATGG + Intronic
923551405 1:234967236-234967258 ATTACAGGCGTGAGACACCGCGG - Intergenic
923563910 1:235062567-235062589 ATTACGGGAGTTACACAAACCGG + Intergenic
923724070 1:236491375-236491397 ATTACAGGTGTTTGCCACCAAGG + Intergenic
923769934 1:236929742-236929764 ATTACAGGTGTGAGCCACCGCGG + Intergenic
924547618 1:245044872-245044894 ATTACAGGTGTGAGCCACCATGG + Intronic
924728801 1:246693571-246693593 ATTACAGGTGTGAGTCACCATGG - Intergenic
1063085201 10:2811006-2811028 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1063547005 10:6991206-6991228 ATTACAGGTGTGAGCCACCATGG - Intergenic
1063743510 10:8853262-8853284 ATTATAGGTGTGAGCCACCCAGG + Intergenic
1063975115 10:11408762-11408784 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1064112699 10:12552377-12552399 ATTGCAGGTGGTACAGACACAGG - Intronic
1064462187 10:15545933-15545955 ATTACAGGAATTACATACCATGG - Intronic
1064471103 10:15636869-15636891 ATTACAGGTGTGAGCCACCGTGG - Intronic
1064516063 10:16149794-16149816 ATTACAGGTGTGAGCCACCATGG - Intergenic
1064677675 10:17778010-17778032 ATTACAGGTGTGAGCCACCGTGG + Intronic
1064805265 10:19123007-19123029 ATTACAGGTGTGAGCCACCATGG + Intronic
1064912809 10:20421461-20421483 AGTTCAGGTGATACACACACAGG + Intergenic
1065169624 10:23013170-23013192 ATTACAGGCGTGAAACACCATGG + Intronic
1065260046 10:23914586-23914608 ATTACAGGTGTGAGCCACCATGG + Intronic
1065353795 10:24819367-24819389 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1065585627 10:27214770-27214792 ATTACAGGTGTGAGCCACCAAGG - Intronic
1065592571 10:27280329-27280351 ATTACAGGTGTGTGACACCACGG + Intergenic
1065657794 10:27969965-27969987 ATTACAGGTGTGTGACACCACGG - Intronic
1065860961 10:29872072-29872094 ATTACAGGGGTAAATCACCCTGG - Intergenic
1066104632 10:32145772-32145794 ATTACAGGTGTAAGCCACCGTGG + Intergenic
1066251496 10:33637409-33637431 ATTACAGGTGTGAGCCACCCAGG - Intergenic
1066328962 10:34396074-34396096 ATTACAGGTGTGAGCCACCATGG - Intronic
1066479291 10:35779849-35779871 ATTACAGGTGTGAGCCACCATGG + Intergenic
1066494350 10:35927712-35927734 ATTACAGGTGTAACATTCCATGG - Intergenic
1067976555 10:51032483-51032505 ATTACAGGTGTGAGCCACCATGG - Intronic
1069175987 10:65289014-65289036 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1069297281 10:66861939-66861961 ATTACAGGTGTGACCCACAGTGG - Intronic
1069375321 10:67787337-67787359 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1069775278 10:70923576-70923598 ATTACAGGTGTGAGCCACCACGG + Intergenic
1070199801 10:74192797-74192819 ATTACAGGTGTGAGCCACCATGG + Intronic
1070319706 10:75345361-75345383 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1071434367 10:85633201-85633223 ATTACAGGTGTGAGCCACCATGG + Intronic
1071852359 10:89586851-89586873 ATTACAGGCGTGAGCCACCCCGG - Intronic
1071875963 10:89843609-89843631 ATTACAAGTGTTAGCCACCATGG + Intergenic
1072163051 10:92786044-92786066 ATTACAGGTGTGAGCCACCATGG - Intergenic
1072529224 10:96302997-96303019 ATTACAGGTGTGAGCCACCATGG - Intergenic
1072666288 10:97395275-97395297 ATTACAGGTGTGAGCCACCATGG - Intronic
1073173275 10:101531462-101531484 ATTACAGGTGTGAGCCACCATGG - Intronic
1073197024 10:101700040-101700062 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1073391639 10:103182361-103182383 ATTACAGGTGTGAGCCACCCAGG - Intronic
1073611818 10:104951616-104951638 ATTACAGGTGTGAGCCACCATGG + Intronic
1073649620 10:105344386-105344408 ATTACAGATGTTACATTCTCTGG - Intergenic
1073787498 10:106906385-106906407 ATTACAGGTGTGAGCCACCGTGG + Intronic
1073809148 10:107133596-107133618 TTTACAGGAGTTAGAAACCCAGG + Intronic
1074079445 10:110156219-110156241 ATTACAGGTGTGAGGCACCACGG - Intergenic
1074849860 10:117431050-117431072 ATTACAGGTGTGAGCCACCATGG + Intergenic
1074981830 10:118626243-118626265 ATTACAGGTGTGAGCCACCATGG - Intergenic
1075597482 10:123742654-123742676 ATTACAGGTGTGAGCCACCACGG + Intronic
1075976137 10:126697203-126697225 ATTATAGGTGTGACCCACCATGG - Intergenic
1076000873 10:126912153-126912175 ATTACAGGTGTGAGCCACCGAGG - Intronic
1076002800 10:126925653-126925675 ATTACAGGCGTGAGCCACCCTGG + Intronic
1076654255 10:132012059-132012081 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1076963894 11:62176-62198 ATTACAGGTGTGAGCCACCATGG - Intergenic
1077584010 11:3436651-3436673 ATTACAGGTGTGAACCACCATGG + Intergenic
1077617697 11:3689908-3689930 ATTACAGGTGTGAGCCACCATGG + Intronic
1077900579 11:6484363-6484385 ATTACAGGTGTGAGCCACCACGG + Exonic
1078227600 11:9406595-9406617 ATTACAGGTGTGAGCCACCGTGG - Intronic
1078924584 11:15862732-15862754 ATTACAGGTGTTAGCCACCGCGG - Intergenic
1080365481 11:31569475-31569497 TTTACAGGTGTCAGACACCGTGG - Intronic
1080461097 11:32455619-32455641 ATTACAGGTGTGAGCCACCACGG - Intergenic
1080892167 11:36418521-36418543 ATTACAGGTGTGAGCCACCGCGG - Intronic
1081161037 11:39748715-39748737 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1081620636 11:44617283-44617305 ATTACAGGTGTGAGCCACCTTGG - Intronic
1082201879 11:49381952-49381974 ATTACAGGTGTGAGCCACCACGG - Intergenic
1082281725 11:50278090-50278112 ATTACAGGCGTGAGCCACCCCGG - Intergenic
1083588178 11:63875523-63875545 ATTACAGGTGTGAGACACTGTGG + Intronic
1083617525 11:64033938-64033960 ATTACAGGTGTGAGCCACCATGG + Intronic
1084240918 11:67819320-67819342 ATTACAGGTGTGAACCACCATGG + Intergenic
1084378778 11:68797395-68797417 ATTACAGGTGTGAGCCACCATGG - Intronic
1084402305 11:68951685-68951707 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1084831521 11:71773386-71773408 ATTACAGGTGTGAACCACCATGG - Intergenic
1085060788 11:73444984-73445006 ATTACAGGTGTGAGCCACCGCGG - Intronic
1086539638 11:87892968-87892990 TTTACAGATGTTAGAGACCCTGG + Intergenic
1086653788 11:89324204-89324226 ATTACAGGTGTGAGCCACCACGG + Intergenic
1087302009 11:96446925-96446947 ATTACAGGTGTGAACCACCATGG + Intronic
1087454464 11:98365672-98365694 ATTACGGGTGCTACTTACCCTGG - Intergenic
1087518245 11:99194876-99194898 ATTACAGGTGTGAGCCACCAAGG + Intronic
1088631619 11:111779085-111779107 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1088883393 11:113989084-113989106 ATTACAGGTGTGAGCCACCGTGG - Intronic
1089537088 11:119167608-119167630 ATTACAGGTGTGAGCCACCGCGG + Intronic
1089581546 11:119484570-119484592 ATTAATGGGGTTACTCACCCAGG + Intergenic
1090216804 11:124974252-124974274 ATTACAGGTGTGAGCCACCACGG + Intronic
1090504476 11:127296871-127296893 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1090621892 11:128567905-128567927 ATTACAGGTGTGAACCACCGCGG + Intronic
1090959163 11:131540436-131540458 ATTACAGGTGTGAGCCACCATGG + Intronic
1091050549 11:132365819-132365841 ATCCCAGGTGTGACACAGCCAGG - Intergenic
1091082233 11:132681680-132681702 ATTACAGGTGTGAGCCACCACGG - Intronic
1091473256 12:748903-748925 ATTACAGGTGTAAGCCACCATGG + Intergenic
1091476261 12:776305-776327 ATTACAGGTGTGAGACACTGTGG + Intronic
1092095967 12:5842151-5842173 ATTACAGGTGTAAGCCACCATGG + Intronic
1092103806 12:5906386-5906408 ATTACAGGTGTGAGTCACCATGG - Intronic
1092212499 12:6656446-6656468 ATTACAGGTGTGAGCCAGCCTGG + Intronic
1092411150 12:8253898-8253920 ATTACAGGTGTGAACCACCATGG + Intergenic
1092838582 12:12516047-12516069 ATTACAGGTGTAAGTCACCATGG + Intronic
1092885921 12:12924257-12924279 ATTACAGGTGTCAGTCACCATGG + Intergenic
1093510449 12:19920917-19920939 ATTACAGGTGTGAGCCACCATGG - Intergenic
1094586341 12:31781095-31781117 ATTACAGGTGTGAGCCACCATGG + Intergenic
1095348221 12:41178166-41178188 ATTACAGGTGTAAGCCACCATGG + Intergenic
1095458365 12:42414306-42414328 ATTACAGGTGTGAGCCACCGCGG + Intronic
1095573991 12:43713764-43713786 ATTACAGGTGTGAGCCACCTCGG + Intergenic
1095813489 12:46396576-46396598 ATTACAGGTGTGAGACCCCTGGG + Intergenic
1097335737 12:58381190-58381212 ATTACAGGTGTGAGCCACCATGG + Intergenic
1097467206 12:59941839-59941861 ATAACAGGTGTTATACAGGCAGG - Intergenic
1097767636 12:63543677-63543699 ATTACAGGTGTAAGCCACCATGG + Intergenic
1097784004 12:63738706-63738728 ATTACAGGTGTAAGCCACCATGG + Intergenic
1098310355 12:69142400-69142422 ATTACAGGTGTGAGTCACCTCGG - Intergenic
1098559624 12:71857221-71857243 ATTACAGGTGTGAGACACTGCGG + Intronic
1098563040 12:71899819-71899841 ATTACAGGTGTGAGCCACCATGG - Intronic
1098944671 12:76576339-76576361 ATTACAGGTGTGAGACACCATGG - Intergenic
1099179652 12:79462171-79462193 ATCACAGTGGATACACACCCTGG + Intergenic
1099179662 12:79462234-79462256 ATCACAGTGGGTACACACCCTGG + Intergenic
1099420904 12:82459352-82459374 ATTACAGGTGTGAGCCACCATGG - Intronic
1099621075 12:85003482-85003504 ATTACAGGTGTGAAACACTGTGG + Intergenic
1099852973 12:88127212-88127234 ATTACAGGTGTGACTCTGCCTGG - Intronic
1100193165 12:92214654-92214676 ATTACAGGTGTGAGTCACCATGG + Intergenic
1100257700 12:92901323-92901345 ATTACAGGTGTGAGCCACCATGG + Intronic
1100364919 12:93911200-93911222 ATTACAGGTGTGAGACACCACGG + Intergenic
1100395708 12:94184684-94184706 ATTACAGGTGTGAGCCACCACGG + Intronic
1100606315 12:96154708-96154730 ATTACAGGTGTGAGCCACCACGG - Intergenic
1101438243 12:104682554-104682576 ATTACAGGTGTTACCAAAACTGG - Intronic
1101466210 12:104952434-104952456 ATTACAGGTATTCCAAAACCTGG - Intronic
1101477451 12:105064253-105064275 ATTACAGGTGTGAGCCACCATGG + Intronic
1101574974 12:105988980-105989002 ATTACAGGTGTGAGCCACCACGG - Intergenic
1101907054 12:108834897-108834919 ATTCCAGGAGTAACTCACCCTGG + Intronic
1102138151 12:110592494-110592516 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1102138408 12:110594386-110594408 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1102164131 12:110792711-110792733 ATTACAGGTGTGAACCACCATGG - Intergenic
1102294978 12:111729503-111729525 ATTACAGGTGTGAGCCACCATGG + Intronic
1102305577 12:111802138-111802160 ATTACAGGTGTGAACCACCACGG - Intronic
1102581780 12:113893402-113893424 ATTACAGGTGTGAGCCACCGCGG + Intronic
1102865754 12:116372816-116372838 ATTACAGGTGTGAGCCAGCCGGG + Intergenic
1102897241 12:116608212-116608234 ATTACAGGTGTGAGCCACCGAGG - Intergenic
1102901074 12:116637528-116637550 ATTACAGGTGTGAACCACCTTGG + Intergenic
1102917104 12:116762239-116762261 ATTACAGGTGTGAGCCACCATGG - Intronic
1103618361 12:122170078-122170100 ATTACAGGTGTGAGACACCACGG + Intronic
1103819168 12:123683551-123683573 ATTACAGGTGTGAGTCACCGTGG + Intronic
1104739531 12:131163160-131163182 CTTATAGGTGTCACACACGCAGG + Intergenic
1104830618 12:131748431-131748453 ATGACAGGTGTAAGCCACCCTGG + Intronic
1105362187 13:19730682-19730704 ATTACAGGTGTGAGCCACCATGG - Intronic
1105374600 13:19831992-19832014 ATTACAGGTGTTCACCACCACGG + Intronic
1105738594 13:23298080-23298102 ATTACAGGTGTGAGCCACCATGG - Intronic
1106185555 13:27406710-27406732 ATTACAGGTGTGAACCACCATGG - Intergenic
1106265264 13:28103743-28103765 ATTACAGGTGTGAGTCACCGCGG + Intergenic
1106663923 13:31831766-31831788 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1106907797 13:34427165-34427187 ATTACAGGTGTGAGCCACCATGG - Intergenic
1108400768 13:50039902-50039924 ATTACAGGTGTGAGCCACCACGG + Intergenic
1109329462 13:60910186-60910208 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1109441922 13:62385740-62385762 ATTACAGGTGTGAACCACCAGGG - Intergenic
1109504778 13:63286218-63286240 ATTACAGGTGCTAGCCACCATGG - Intergenic
1110977248 13:81854478-81854500 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1112601781 13:100862749-100862771 ATTACAGGTGTGAGCCACCGAGG + Intergenic
1113253093 13:108476051-108476073 ATTACAGGTGTGAACCACACCGG - Intergenic
1113983360 13:114294837-114294859 ATTACAGGTGTGAGCCACCGCGG - Intronic
1114007485 14:18330868-18330890 ATTACAGGTGTGAGCCACCACGG - Intergenic
1114535994 14:23422900-23422922 ATTACAGGTGTGAGCCACCGCGG + Intronic
1115036953 14:28869438-28869460 ATTACAGGCGTGAGCCACCCTGG - Intergenic
1115653811 14:35423580-35423602 ATTACAGGTGTGAGCCACCACGG + Intergenic
1115795033 14:36925571-36925593 ATTACAGGTGTGAGCCACCGTGG - Intronic
1116065616 14:39978935-39978957 ATTACAGGTGTGAGTCACCATGG - Intergenic
1116352418 14:43880922-43880944 ATTACAGGTGTGAGCCACCCTGG - Intergenic
1116824262 14:49656833-49656855 ATTATAGGTGTGAGCCACCCTGG - Intronic
1117146249 14:52839348-52839370 ATTACAGGTGTCAGCCACCATGG + Intergenic
1118582326 14:67314815-67314837 ATTACAGGTGTGAGCCACCAGGG - Intronic
1118710591 14:68515718-68515740 ATTACAGGTATGAGCCACCCAGG + Intronic
1118882200 14:69838807-69838829 ATTACAGGTGTGAGGCACCGTGG + Intergenic
1119305384 14:73604003-73604025 ATTACAGGTGTGAGCCACCATGG + Intergenic
1119741978 14:77019672-77019694 ATTACAGGTGTGAGCCACCATGG - Intergenic
1119791644 14:77355467-77355489 ATTACAGGCGTGACCCACCATGG + Intronic
1119836700 14:77756608-77756630 ATTACAGGTGTGAGCCACCATGG - Intronic
1121218762 14:92269077-92269099 ATTACAGGTGTGAGCCACCATGG + Intergenic
1121543027 14:94742798-94742820 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1121765486 14:96481967-96481989 ATTACAGGTGTGAGCCACCATGG + Intronic
1122239563 14:100353519-100353541 ATTACAGGTGTGAGCCACCATGG + Intronic
1122330713 14:100910626-100910648 GTGGCAGGTGGTACACACCCAGG + Intergenic
1122671601 14:103376988-103377010 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1122830966 14:104395594-104395616 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1123022193 14:105405027-105405049 ATTACAGGTGTGAGCCACCATGG - Intronic
1123716206 15:23034584-23034606 ATTACAGGCGTGAGCCACCCCGG - Intronic
1124383311 15:29185833-29185855 ATTACAGGTGTGAGCCACCACGG + Intronic
1124596883 15:31098731-31098753 ATTTCAGGCATTACCCACCCTGG + Intronic
1125051811 15:35307996-35308018 ATTACAGGTGTGAGCCACCATGG - Intronic
1125071374 15:35557965-35557987 ATAACAGGTGTGAGACACCATGG - Intergenic
1125155084 15:36576969-36576991 ATAACTGGTGTAACACACCAGGG + Intergenic
1125299716 15:38241688-38241710 ATTACAGGTGTGAGCCACCATGG + Intergenic
1125936090 15:43637094-43637116 ATTACAGGTGTGAGCCACCATGG + Intronic
1125985805 15:44050632-44050654 ATTACAGGTGTGAGGCACACTGG + Intronic
1126088501 15:45031050-45031072 ATTACAGGTGTGAACCACCATGG - Intronic
1126503427 15:49374679-49374701 ATTACAGGTGTTCACCACCATGG + Intronic
1127084634 15:55413483-55413505 ATTACAGGCGTGAGACACCACGG - Intronic
1127131983 15:55875589-55875611 ATTACAGGTGTTAGCCACCACGG + Intronic
1127251366 15:57241717-57241739 ATTACAGGTGTGAGCCACCACGG - Intronic
1127684975 15:61334613-61334635 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1127991234 15:64119454-64119476 ATTACAGGTGTGAGCCACCATGG - Intronic
1128123348 15:65171171-65171193 ATTACAGGCGTTAGCCACCTTGG - Intronic
1128170567 15:65508577-65508599 ATTACAGGTGTGAGCCACCTCGG - Intronic
1128350136 15:66882889-66882911 ATTACAGGTGTGAGCCACCGAGG - Intergenic
1128486889 15:68101171-68101193 ATTACAGGTGTGAGCCACCGTGG + Intronic
1129241341 15:74253986-74254008 ATTACAGGTGTGAGCCACCCTGG + Intronic
1129249100 15:74298676-74298698 ATTACAGGCATTCGACACCCTGG + Intronic
1129358434 15:75008773-75008795 ATTACAGGTGTGAGTCACCATGG + Intronic
1129414865 15:75369974-75369996 ATTACAGGTGTGAGCCACCCTGG - Exonic
1129535135 15:76307755-76307777 ATTACAGGTGTCAGCCACCATGG + Intronic
1130208788 15:81903589-81903611 ATTACAGGTGTGAGCCACCACGG - Intergenic
1131074169 15:89484506-89484528 ATTACAGGTGTGAGCCACCATGG - Intronic
1131232554 15:90670320-90670342 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1131560810 15:93437820-93437842 ATTACAGGTGTCCCCCACCATGG + Intergenic
1133352391 16:5110218-5110240 ATTACAGGTGTGAACCACCATGG + Intergenic
1134080008 16:11318671-11318693 ATTACAGGTGTGAGCCACCGTGG + Intronic
1134105460 16:11482615-11482637 ATTACAGGTGTGACCCACCATGG - Intronic
1134148871 16:11789805-11789827 ATTACAGGTGTGAGCCACCATGG - Intronic
1134243016 16:12519713-12519735 ATTACAGGTGTGAGACATCACGG - Intronic
1134310543 16:13071917-13071939 ATTATAGGTGTGACCCACCGTGG + Intronic
1134476621 16:14579699-14579721 ATTACAGGTGTGAACCACCGTGG - Intronic
1134991814 16:18706950-18706972 ATTACAGGTGTGACAAATCTTGG - Intergenic
1135144215 16:19947632-19947654 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1135181954 16:20282617-20282639 ATTATAGGTGATACACAGGCAGG + Intergenic
1135753562 16:25077203-25077225 ATTACAGGTGTGAGCCACCATGG - Intergenic
1135767051 16:25186860-25186882 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1135772829 16:25230247-25230269 ATTACAGGCGTGAAACACCATGG - Intergenic
1136377619 16:29874842-29874864 ATTACAGGTGTGAGCCACCACGG + Intronic
1137262835 16:46845010-46845032 ATTACAGGCGTGAGCCACCCAGG + Intergenic
1137336247 16:47552535-47552557 ATTACAGGTGTGAGCCACCACGG - Intronic
1137632626 16:49957611-49957633 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1137950032 16:52774734-52774756 ACTACAGAGGTCACACACCCAGG - Intergenic
1138068441 16:53966139-53966161 ATTACAGGTGTGAGCCACCATGG + Intronic
1138373497 16:56546192-56546214 ATTACAGTTGTGACCCACCGTGG + Intergenic
1138511641 16:57512131-57512153 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1139687401 16:68615152-68615174 ATTACAGGTGTGAACCACCATGG - Intergenic
1140499652 16:75422868-75422890 ATTACAGGTGTGAGAAAACCTGG - Intronic
1140742336 16:77952583-77952605 ATTACAGGTGTGAGTCACCAGGG - Intronic
1140842973 16:78858950-78858972 ATTACAGGTGTGAGCCACCACGG + Intronic
1203140900 16_KI270728v1_random:1765196-1765218 ATTACAGGTGTGAGCCACCATGG + Intergenic
1142865585 17:2789319-2789341 ATTACAGGTGTGAGCCACCGTGG + Intronic
1143219829 17:5252383-5252405 ATTACAGGTGTGAGCCACCACGG - Intergenic
1143247071 17:5496071-5496093 ATTACAGGCGTTAGCCACCGTGG - Intergenic
1143614305 17:8040269-8040291 ATTACAGGTGTGAGCCACCACGG - Intronic
1144184355 17:12782730-12782752 ATTACAGGTGTGAGCCACCACGG + Intergenic
1144526060 17:15990967-15990989 ACTACAGGTGGCACACACCGAGG - Intronic
1144692564 17:17277858-17277880 ATTACAGGTGTGAGCCAGCCTGG - Intronic
1144992150 17:19240517-19240539 ATTACAGGTGTGAGCCACCATGG + Intronic
1145742926 17:27291612-27291634 ATTACAGGCGTGAGCCACCCCGG - Intergenic
1146026210 17:29323587-29323609 ATTACAGGTGTGAGCCACCATGG - Intergenic
1146095179 17:29923181-29923203 ATTACAGGTGTGAGCCACCGTGG + Intronic
1146205455 17:30901292-30901314 ATTACAGGTGTGAGCCACCAAGG + Intronic
1146302649 17:31702039-31702061 ATTACAGGTGTGAGCCACCACGG + Intergenic
1146402941 17:32514364-32514386 ATTACAGGTGTAAGCCACCGCGG + Intronic
1146657394 17:34642814-34642836 ATTATAGGTGTGAGCCACCCTGG + Intergenic
1146753786 17:35408149-35408171 ATTACAGGTGTAAGCCACCACGG - Intergenic
1146904958 17:36612334-36612356 ATTACAGGCCATACACACACAGG + Intergenic
1147216834 17:38905253-38905275 ATTACAGGTGTGAACCACCACGG - Intronic
1147321351 17:39648010-39648032 ATTACAGGTGTGAGCCACCGCGG - Intronic
1147349258 17:39827268-39827290 ATTACAGGTGTGAGTCACCACGG + Intronic
1147655055 17:42084888-42084910 ATTACAGGTGTGAGCCACCATGG + Intergenic
1148137566 17:45304275-45304297 ATTACAGGTGTGAGCCACCATGG + Intronic
1148162514 17:45458857-45458879 ATTACAGGTGTGAGCCACCATGG - Intronic
1148606715 17:48935095-48935117 ATTACAGGTGTGAGACACCACGG - Intronic
1148879675 17:50716251-50716273 ATTACAGGTGTGAGCCACCATGG + Intergenic
1149464935 17:56870718-56870740 ATTACAGGTGTTATTCACAGAGG - Intergenic
1149615641 17:57995636-57995658 ATTACAGGTGTTTCTCACTTGGG + Intronic
1149716626 17:58796830-58796852 ATTACAGGTGTGAGCCACCATGG - Intronic
1149762634 17:59246343-59246365 ATTACAGGTGTGAGCCACCGAGG - Intronic
1149826676 17:59834895-59834917 ATTACAGGTGTGAACCACCGAGG + Intronic
1149933645 17:60781323-60781345 ATTACAGGTGTGAACCACCATGG - Intronic
1150157101 17:62863027-62863049 ATTACAGGTGTGAGCCACCACGG + Intergenic
1150393744 17:64805521-64805543 ATTACAGGTGTGAGCCACCATGG - Intergenic
1150421646 17:65042083-65042105 ATTACAGGTGTGAGCCACCGCGG - Intronic
1150552638 17:66224793-66224815 ATTACAGGTGTGAGCCACCATGG - Intronic
1150709521 17:67518685-67518707 ATTACAGGTGTGAGCCACCATGG - Intronic
1150877457 17:68985684-68985706 ATTACAGGTGTGAGCCACCTGGG - Intronic
1150889845 17:69135152-69135174 ATTACAGGTGTGAGCCACCATGG + Intronic
1152081826 17:78192282-78192304 ATTACAGGTGTGAGCCACCATGG + Intronic
1152402635 17:80077249-80077271 ATTACAGGTGTGAGCCACCACGG - Intronic
1152980708 18:273526-273548 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1153901545 18:9621689-9621711 ATTACAGGTGTGAACCACCATGG + Intergenic
1154073084 18:11173035-11173057 ATTACAGGTGTGAGCCACCCCGG - Intergenic
1154209196 18:12364941-12364963 ATTACAGGTGTGAGCCACCACGG + Intronic
1154275857 18:12959452-12959474 ATTACAGGTGTGAGCCACCGTGG + Intronic
1154277322 18:12973571-12973593 ATTACAGGTGTGAGCCACCACGG + Intronic
1154510701 18:15098691-15098713 ATTACAGGTGTGAGCCACCAAGG - Intergenic
1155140419 18:23039669-23039691 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1155215258 18:23637669-23637691 ATTACAGGTGTGAGCCACCTTGG + Intronic
1155731200 18:29160965-29160987 ATTACAGGTGTGAGCCACCATGG - Intergenic
1157116857 18:44870222-44870244 TTTAAAGGTGTTTCACATCCAGG + Intronic
1157261196 18:46176887-46176909 ATTACAGGTGTGAGCCACCACGG + Intronic
1157650209 18:49320744-49320766 ATTACAGGTGTGAGCCACCGTGG + Intronic
1157758318 18:50238523-50238545 ATTACAGGTGTGAGCCACCATGG + Intronic
1157818257 18:50746778-50746800 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1158026463 18:52903478-52903500 ATTACAGGTGTGAACCACCATGG + Intronic
1158683355 18:59589492-59589514 ATTAAAAATGTTACACACCATGG + Intronic
1159023611 18:63163117-63163139 ATTACAGGTGTGAGTCACCATGG + Intronic
1159043039 18:63343331-63343353 ATTACAGGTGTGAGACACCATGG + Intronic
1160282346 18:77503207-77503229 ACTAAAAGTGTTACACACACAGG + Intergenic
1160414478 18:78698536-78698558 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1160640697 19:131808-131830 ATTACAGGTGTGAGCCACCATGG - Intergenic
1160871011 19:1278046-1278068 ATTACAGGTGTGAGCCACCGTGG + Intronic
1160931986 19:1575154-1575176 ATTACAGGTGTGAACCACCATGG - Intronic
1161114139 19:2487662-2487684 ATTACAGGTGTGAGCCACCATGG + Intergenic
1161240950 19:3223652-3223674 ATTACAGGTGTGAGCCACCACGG + Intergenic
1161343804 19:3757458-3757480 ATTACAGGTGTGAGCCACCGCGG - Intronic
1161355311 19:3816026-3816048 ATTACAGGTGTGAGCCACCCCGG + Intronic
1161488154 19:4546887-4546909 ATTACAGGTGTGAGCCACCACGG + Intronic
1162451916 19:10760170-10760192 ATTACAGGTGTGACCCTCCATGG + Intronic
1162622228 19:11852781-11852803 ATTACAGGTGTGAGCCACCATGG + Intronic
1163040593 19:14599359-14599381 ATTACAGGTGTGAGCCACCATGG + Intronic
1163045942 19:14642236-14642258 ATTACAGGTGTGAGACACCATGG - Intronic
1163065354 19:14788360-14788382 ATTACAGGTGTAAACCACCGTGG + Intergenic
1163524959 19:17815239-17815261 ATTACAGGTGTGAGCCACCACGG - Intergenic
1163623064 19:18372277-18372299 ATTACAGGTGTTTACCACCATGG - Intergenic
1164001109 19:21100248-21100270 ATTACAGGTGTGAGACACTGCGG - Intronic
1165336604 19:35174673-35174695 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1165618759 19:37226382-37226404 ACTCCTGGTGTTACACATCCAGG + Intronic
1165878801 19:39028459-39028481 ATTACAGGTGTGAGCCACCACGG - Intronic
1167178282 19:47881307-47881329 ATTACAGGTGTGAGCCACCATGG + Intronic
1167267854 19:48492458-48492480 ATTACAGGCGTGAGCCACCCGGG + Intronic
1167316287 19:48764988-48765010 ATTACAGGTGTGAACCACCACGG + Intergenic
1167580934 19:50342357-50342379 ATTACAGGTGTGAGCCACCATGG + Intronic
1167585266 19:50371106-50371128 ATTACAGGTGTGAGCCACCGTGG + Intronic
1168143405 19:54404701-54404723 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1168286525 19:55337546-55337568 ATTACAGGTGTGAGCCACCATGG - Intergenic
1168551183 19:57296387-57296409 ATTACAGGTGTAAGCCACCGCGG + Intergenic
1168724701 19:58574684-58574706 ATTACAGGTGTGAGCCACCGCGG + Intergenic
925318639 2:2944229-2944251 AGTACAGGTGTCTCACACTCTGG - Intergenic
925656914 2:6159021-6159043 ATTACAGGTGTGAGCCACCATGG + Intergenic
927516810 2:23676515-23676537 ATTACAGGTGTGAGCCACCATGG - Intronic
927559881 2:24062585-24062607 ATTACAGGTGTGAGCCACCACGG + Intronic
927581853 2:24257728-24257750 ATTACAGGTGTGAGCCACCACGG + Intronic
927780988 2:25939239-25939261 ATTACAGGTGTGAGCCACCGCGG + Intronic
928037318 2:27836997-27837019 ATTACAGGTGTGAGCCACCTCGG - Intronic
928514698 2:32034723-32034745 ATTACAGGTGTGAGTCACCGTGG - Intronic
928546907 2:32336871-32336893 ATTACAGGCGTGAGCCACCCAGG - Intergenic
929600049 2:43199271-43199293 ATTACAGGTGTGAGCCACCACGG + Intergenic
930212861 2:48660912-48660934 ATTACAGGTGTGAGACACCATGG + Intronic
930647747 2:53929742-53929764 ATTACAGGTGTGAGCCACCATGG - Intronic
930665206 2:54094809-54094831 ATTACAGGTGTGAGCCACCATGG + Intronic
931072885 2:58673772-58673794 ATTACAGGTGTGAGCCACCACGG + Intergenic
931350660 2:61485151-61485173 ATTACAGGTGTAAGCCACCATGG + Intronic
931375877 2:61707669-61707691 ATGACAGGTGTGAGCCACCCCGG + Intergenic
931430973 2:62208847-62208869 ATAACAGGTCTGACACACCAAGG - Intronic
932153390 2:69393217-69393239 ATTACAGGTGTGAGCCACCGCGG + Intergenic
932304017 2:70688821-70688843 ATTACAGGCGTGACCCACCACGG - Intronic
932688274 2:73891863-73891885 ATTACAGGTGTGAGCCACCATGG - Intergenic
933107333 2:78347485-78347507 ATTACAGGTGTGAGCCACCATGG + Intergenic
933236870 2:79874054-79874076 CTTTCATGTGTTACACACACAGG + Exonic
933827957 2:86180611-86180633 ATTACAGGTGTGAGCCACCATGG - Intronic
933889224 2:86751276-86751298 CTACCAGGTGTTACACACACAGG - Intronic
934929220 2:98406764-98406786 ATTACAGGTGTGAGCCACCGTGG - Intergenic
935049999 2:99517387-99517409 ATTACAGGTGTGAACCACCAAGG + Intergenic
935061436 2:99611610-99611632 ATTACAGGTGTGAGCCACCGTGG - Intronic
936409764 2:112247299-112247321 ATTACAGGTGTGAGCCACCATGG - Intronic
937117174 2:119416099-119416121 ATTACAGGCGTGACTCACCATGG - Intergenic
938505923 2:131883151-131883173 ATTACAGGTGTGAGCCACCAAGG - Intergenic
938846488 2:135215189-135215211 ATTACAGGTGTGAGCCACCATGG + Intronic
939288963 2:140168808-140168830 ATTACAGGTGTAAGCCACCGTGG - Intergenic
939742625 2:145928705-145928727 ATTACAGGTGTGAGCCACCATGG - Intergenic
940855045 2:158723200-158723222 AGTCCAGCTGTTACAAACCCAGG - Intergenic
941100871 2:161293697-161293719 ATTACAGGTGTGAGCCACCACGG + Intergenic
942011351 2:171765683-171765705 ATTACAGGTGTGAGCCACCATGG - Intergenic
942293605 2:174496672-174496694 ATTATAGGTGTAACCCACCATGG + Intergenic
942359363 2:175156095-175156117 ATTACAGGTGTGAGCCACCATGG - Intronic
943039935 2:182792412-182792434 ATTACAGCTGTTATAAACCCTGG + Exonic
943076545 2:183202693-183202715 ATTACAGGTGTGAGCCACCATGG - Intergenic
944046405 2:195416202-195416224 ATTACAGGTGTGAGCCACCGCGG - Intergenic
944106745 2:196087183-196087205 ATTACAGGTGTGAGCCACCATGG + Intergenic
944218818 2:197281978-197282000 ATTACAGGTGTGAGCCACCACGG - Intronic
944710896 2:202334143-202334165 ATTACAGGCGTGAGACACCCTGG + Intergenic
944720715 2:202420974-202420996 ATTACAGGTGTGAGCCACCATGG - Intronic
944740869 2:202611403-202611425 ATTACAGGTGTAAGCCACCAAGG - Intergenic
944756221 2:202764541-202764563 ATTACAGGTGTGAACCACCATGG + Intronic
945285955 2:208082041-208082063 ATTACAGGTGTGAGCCACCATGG - Intergenic
945511192 2:210704960-210704982 ATTACAGCTGTCAAACTCCCTGG + Intergenic
946072208 2:217044056-217044078 ATTACAGGCGTGAGCCACCCCGG + Intergenic
946925574 2:224623427-224623449 ATTACAGGTGTGAGCCACCGTGG + Intergenic
947297120 2:228643585-228643607 ATTACAGGTGTGAGCCACCATGG - Intergenic
948194347 2:236084167-236084189 ATTACAGCTGTTCCCCACCGGGG - Intronic
948202486 2:236139725-236139747 ATTACAGGTGTGAGTCACCTTGG - Intergenic
948310742 2:236984232-236984254 ATTACTGTTGGTATACACCCAGG + Intergenic
1169256894 20:4106514-4106536 ATTACAGGTGTGAGCCACCATGG - Intergenic
1170185876 20:13589956-13589978 ATTACAGGTGTGAGCCACCATGG - Intronic
1171875623 20:30572921-30572943 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1171995400 20:31727036-31727058 ATTACAGGTGTGAGCCACCATGG - Intergenic
1172131233 20:32657214-32657236 ATTACAGGTGTGAGCCACCATGG - Intergenic
1172177502 20:32981114-32981136 GTGACAGGTGTGACACACCGTGG + Intergenic
1172251299 20:33481076-33481098 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1172282654 20:33719167-33719189 ATTACAGGTGTGAGCCACCGTGG + Intronic
1172416594 20:34773795-34773817 ATTACAGGTGTGACCCACCGTGG + Intronic
1172628417 20:36362016-36362038 ATTACAGGTGTGAGCCACCATGG - Intronic
1172659363 20:36557002-36557024 ATTACAGGTGTGAGCCACCATGG - Intergenic
1172674397 20:36657596-36657618 CTTCCAGCTGTTACACACTCTGG + Intronic
1172690738 20:36787925-36787947 ATTACAGGTGTGAGCCACCATGG - Intronic
1172978641 20:38924958-38924980 ATTACAGGTGTAAGTCACCATGG + Intergenic
1173275854 20:41581401-41581423 ATTACAGGTGTGAGCCACCGTGG - Intronic
1173302582 20:41817210-41817232 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1173723180 20:45277816-45277838 ATTACAGGTGTGAGCCACCATGG - Intergenic
1174315472 20:49697213-49697235 GACACAGGTGCTACACACCCAGG + Intronic
1174360767 20:50027740-50027762 GTGACACTTGTTACACACCCTGG - Intergenic
1174621443 20:51877810-51877832 ATTACAGGTGTGACCCACCAAGG - Intergenic
1174896596 20:54455768-54455790 ATTACAGGTGTAAGCCACCATGG + Intergenic
1175162047 20:57015818-57015840 AATACAGATGCTACACACACAGG + Intergenic
1175442055 20:58999307-58999329 ATTACAGGTGTGAGCCACCGCGG + Intronic
1176787150 21:13270587-13270609 ATTACAGGTGTGAGCCACCAAGG + Intergenic
1177039916 21:16095721-16095743 ATTACAGGTGTGAGCCACCACGG - Intergenic
1177723306 21:24935326-24935348 ATTACAGGTGTGAGCCACCACGG + Intergenic
1177986324 21:27979221-27979243 ATTACAGGTGTGAACCACCAAGG + Intergenic
1178383333 21:32129799-32129821 ATTACAGGTGTGAGGCACCATGG - Intergenic
1178476535 21:32942303-32942325 ATTACAGGTGTGAGCCACCTGGG - Intergenic
1178973664 21:37203670-37203692 ATTACAGGCGTTAGCCACCGCGG - Intergenic
1179048050 21:37864382-37864404 ATTACAGGTGTGAGCCACCATGG + Intronic
1179108149 21:38421989-38422011 ATTACAGGTGTGAGCCACCATGG + Intronic
1180112393 21:45667279-45667301 ATTACAGGTGTGAGCCACCATGG + Intronic
1180249162 21:46568245-46568267 ATTACAGGTGTAAGCCACCGTGG - Exonic
1180431992 22:15261673-15261695 ATTACAGGTGTGAGCCACCACGG - Intergenic
1180514558 22:16129602-16129624 ATTACAGGTGTGAGCCACCACGG - Intergenic
1180882048 22:19211493-19211515 ATTACAGGCGTGAGACACCGGGG - Intronic
1181597303 22:23924482-23924504 ATTACAGGTGTGAGCCTCCCTGG - Intergenic
1181742133 22:24929621-24929643 ATTACAGGTGTGAGCCACCATGG - Intergenic
1181798215 22:25325943-25325965 ATTACAGGTGTGAGCCACCACGG - Intergenic
1182240165 22:28909864-28909886 ATTACAGGTGTGAGCCACCATGG + Intronic
1182625404 22:31642185-31642207 ATTCCAGGTGTGAGCCACCCTGG - Intronic
1182629765 22:31676234-31676256 ATTACAGGCGTGAGACACCGTGG + Intronic
1183888588 22:40906211-40906233 GTTACAGGTGTGAGCCACCCTGG + Intronic
1184223868 22:43117944-43117966 ATTACAGGTGTAAGCCACCGCGG + Intronic
1184486704 22:44784128-44784150 ATTACAGGTGTGAGTCACCGTGG - Intronic
1185137837 22:49083255-49083277 ATTACAGGTGTGAGTCACCGCGG + Intergenic
1185312961 22:50166727-50166749 ATTACAGGTGTGAGCCACGCTGG - Intergenic
1185407867 22:50665590-50665612 ATTACAGGTGTGAACCACCTTGG + Intergenic
949996644 3:9622493-9622515 ATTACAGGTGTGAGCCACCGGGG + Intergenic
949999858 3:9648779-9648801 ATTACAGGCGTGAGACACCGCGG + Intergenic
950329780 3:12147090-12147112 ATTTCAGCTGTCACACGCCCTGG + Intronic
950912947 3:16614022-16614044 ATTACAGGTGTTAACCACCACGG + Intronic
951879560 3:27466552-27466574 ATTACAGGTGTGAATCACCACGG - Intronic
952316110 3:32233799-32233821 ATTACAGGTGTGAGTCACCATGG - Intergenic
953085917 3:39667183-39667205 ATTACAGGTGTGAGCCACCGCGG - Intergenic
953175083 3:40543431-40543453 ATTACAGGTGTGAGCCACCACGG + Intronic
953991232 3:47484992-47485014 ATTACAGGTGTGAGCCACCACGG + Intergenic
954029845 3:47811225-47811247 ATTACAGGTGTGAGCCACCGTGG + Intronic
954067930 3:48121765-48121787 ATTACAGGTGTGAGCCACCGCGG + Intergenic
954077949 3:48194961-48194983 ATTACAGGTGTGAGCCAGCCTGG + Intergenic
954248461 3:49350082-49350104 CATACAGGTGTGACACACCTGGG - Intergenic
954265609 3:49468808-49468830 ATTACAGGTGTGAGCCACCGCGG + Intronic
955235071 3:57131910-57131932 ATTACAGGTGTGAGCCACCATGG - Intronic
955242678 3:57193152-57193174 ATTACAGGTGTGAACCACCATGG + Intergenic
955289796 3:57681190-57681212 ATTACAGGTGTGAGCCACCGTGG - Intronic
955311517 3:57892669-57892691 ATTACAGGTGTGAGTCACCAAGG - Intronic
955876776 3:63498838-63498860 ATTACAGGTGTGAGCCACCATGG - Intronic
955965790 3:64388055-64388077 ATTACAGGTGTGAGCCACCATGG - Intronic
956258288 3:67308045-67308067 ATTACAGGTGTGAGCCACCATGG + Intergenic
956595429 3:70961502-70961524 ATTACAGGCGTGAGACACCATGG + Intronic
956824479 3:72984951-72984973 ATTACAGGTGTGAGCCACCAAGG - Intronic
956837321 3:73106156-73106178 ATTACAGGTGTGAGCCACCATGG + Intergenic
957056380 3:75446124-75446146 ATTACAGGTGTGAACCACCATGG + Intergenic
957496605 3:80999649-80999671 ATTACAGGTCTTAAAGACTCAGG + Intergenic
957725809 3:84065018-84065040 ATTACAGGTGTGAGCCACCACGG + Intergenic
958434744 3:94082607-94082629 ATTCCAGCTGCTACACACCCTGG - Intronic
958527014 3:95275103-95275125 ATTACAGGTGTGAGCCACCGTGG - Intergenic
958612545 3:96446213-96446235 ATTACAGGTGTGAGCCACCATGG - Intergenic
958644780 3:96855939-96855961 ATTACAGGTGAAAGCCACCCAGG - Intronic
958781332 3:98546962-98546984 ATTACAGGTGTGAGCCACCGTGG - Intronic
958941433 3:100319699-100319721 ATTACAGGTGTGAGCCACCGTGG + Intronic
959835897 3:110917525-110917547 ATTACATATGTTACTCTCCCTGG + Intergenic
959924643 3:111907763-111907785 ATTACAGGTGTGAGCCACCGTGG + Intronic
959963126 3:112323535-112323557 ATTACAGGTGTGAGACACTGTGG - Intergenic
960910460 3:122644300-122644322 ATTACAGGTGTGAGCCACCGCGG - Intergenic
961181898 3:124884425-124884447 ATTACAGGTGTGAGCCACCACGG - Intronic
961245809 3:125452367-125452389 ATTACAGGTGTGAGCCACCACGG + Intronic
961298004 3:125902586-125902608 ATTACAGGTGTGAACCACCATGG - Intergenic
962511521 3:136105686-136105708 ATTACAGGTGTGAGCCACCGTGG - Intronic
962768264 3:138587507-138587529 ATTACAGGTGTGAGCCACCATGG - Intronic
962786759 3:138775922-138775944 ATTACAGGTGTGAGCCACCGCGG - Intronic
963057044 3:141194310-141194332 ATTACAGGTGTGAGCCACCGCGG + Intergenic
963122156 3:141785489-141785511 ATTACAGGTGTGAGCCACCACGG - Intronic
963131687 3:141864259-141864281 ATTACAGGTGTGAGCCACCGTGG + Intergenic
963437996 3:145296301-145296323 ATTACAGGTGTCTCACACCCAGG - Intergenic
964391699 3:156204555-156204577 ATTACAGGTGTGAGCCACCATGG - Intronic
965205918 3:165719209-165719231 ATTACAGGTGTGAGCCACCATGG + Intergenic
965536060 3:169824784-169824806 ATTACAGGTGTAAGCCACCATGG + Intronic
966197645 3:177329363-177329385 ATTACAGGTGTGAGCCACCACGG - Intergenic
966396403 3:179508258-179508280 ATTACAGGTGTGAGCCACCATGG + Intergenic
967015215 3:185475576-185475598 ATTACAGGTGTGAGCCACCGCGG - Intronic
967173612 3:186843384-186843406 ATTACAGGTGTGAGCCACCATGG - Intronic
967176878 3:186868625-186868647 ATTACAGGTGTGAGCCACCGCGG + Intergenic
968345740 3:198005841-198005863 ATTACAGGTGTGAGCCAGCCTGG - Intronic
968539968 4:1162454-1162476 ATTACAGGTGTGAGCCACCGTGG + Intergenic
968999198 4:3966402-3966424 ATTACAGGTGTGAACCACCATGG + Intergenic
969085825 4:4655684-4655706 ATTACAGGTGTGAGCCACCATGG - Intergenic
969637927 4:8380118-8380140 ACTACAAGTTTTACAGACCCTGG + Intronic
969814704 4:9678513-9678535 ATTACAGGTGTGAACCACCATGG - Intergenic
969860248 4:10029907-10029929 ATTACAGGTGTGAGCCACCATGG + Intronic
969914989 4:10482001-10482023 ATTACAGGTGTGAGCCACTCTGG + Intergenic
970648414 4:18149586-18149608 ATTACAGGTGTGAGACACCATGG + Intergenic
972319049 4:37955861-37955883 ATTACAGGCGTGAGACACCACGG - Intronic
972483302 4:39518588-39518610 ATTACAGGTGTGAGCCACCGCGG + Intronic
973230152 4:47831516-47831538 ATCCCATGTGTTCCACACCCAGG + Intronic
973893982 4:55394588-55394610 ATTACAGGTGTGAGCCACCGCGG - Intergenic
974051902 4:56949638-56949660 ATTACAGGTGTGAGCCACCGCGG + Intergenic
974256237 4:59458831-59458853 ATTACAGGCGTGAGACACCGCGG - Intergenic
975055715 4:69926689-69926711 ATTACAGATTTTAAAAACCCTGG + Intergenic
975171311 4:71234705-71234727 ATTACAGGTGTGAGCCACCACGG + Intronic
975203985 4:71623644-71623666 ATTACAGGTGTGAGCCACCATGG + Intergenic
975566377 4:75759768-75759790 ATTACAGGTGTGCAACACCATGG - Intronic
975638318 4:76472964-76472986 ATTACAGGTGTGAGCCACCACGG + Intronic
976126362 4:81837506-81837528 ATTACTGGTGTAACCCACCACGG + Intronic
976636592 4:87292448-87292470 ATTACAGGTGTGAGCCACCACGG + Intergenic
977233739 4:94481880-94481902 ATTACAGGTGTGAGCCACCGTGG + Intronic
977931404 4:102753807-102753829 ATTACAGGTGTGAGCCACCATGG - Intronic
978153498 4:105464197-105464219 ATTCCATGTGTCTCACACCCAGG - Intronic
978436110 4:108686161-108686183 ATTACAGGTGTGAGCCACCATGG + Intergenic
979771929 4:124536616-124536638 ATTACAGGTGTGAGCCACCACGG + Intergenic
979836177 4:125370870-125370892 ATTACAGGCGTGAGCCACCCAGG - Intronic
979893187 4:126126388-126126410 ATTACAGGCGTGAGACACCGAGG - Intergenic
980387291 4:132102789-132102811 ATTACAGGTGTGAGCCACCATGG - Intergenic
980581921 4:134765984-134766006 ATTAGAAGAGTAACACACCCAGG + Intergenic
981132802 4:141176940-141176962 ATTACAGGTGTGAACCACCATGG - Intronic
982007152 4:151074831-151074853 ATTACAGGTGTGAGCCACCATGG - Intergenic
982016930 4:151163854-151163876 ATTACAGGTGTGAGCCACCATGG + Intronic
982262008 4:153502215-153502237 ATTACAGGTGTGAACCACCGCGG + Intronic
983327245 4:166272909-166272931 ATTACAGGTGTGATCCACCATGG - Intergenic
983482379 4:168290627-168290649 ATTACAGGTGTGAGCCACCGCGG + Intronic
983585752 4:169352931-169352953 ATTACAGGTGTGAGCCACCGCGG - Intergenic
983858700 4:172677647-172677669 ATTACAGGTGTTGGCCACCGTGG - Intronic
984634047 4:182092064-182092086 ATTACAGGTGTGGCCCACCGTGG - Intergenic
984711840 4:182892392-182892414 ATTACAGGTGTGAGCCACCTGGG - Intronic
985068177 4:186143802-186143824 ATTACAGGCGTGAGCCACCCTGG + Intronic
985419878 4:189774050-189774072 ATTACAGCTGTTATGCACCAGGG + Intergenic
985567419 5:626544-626566 ATTACAGGTGTTAGCCACTGTGG - Intronic
985817911 5:2140287-2140309 ATTACAGGTGTGAGCCACCATGG - Intergenic
986099389 5:4593121-4593143 ATTACAGGTGTGAGCCACCATGG - Intergenic
987228656 5:15869834-15869856 ATTACAGGTGTGAGCCACCATGG - Intronic
987911520 5:24153742-24153764 ATTACAGGTGTGAGCCACCATGG - Intronic
988474637 5:31572969-31572991 ATTACAGGTGTAAGCCACCACGG - Intergenic
988538953 5:32091998-32092020 ATTACAGGTGTGAGCCACCACGG - Intronic
988723722 5:33904369-33904391 ATTACAGGTGTGAGCCACCGTGG - Intergenic
988895135 5:35664415-35664437 ATTACAGGTGTGAGCCACCATGG - Intronic
989043434 5:37251303-37251325 ATTACAGGTGTGAGCCACCGTGG + Intergenic
989468054 5:41781174-41781196 ATTACAGGTGTGAGCCACCAAGG + Intronic
991441962 5:66660113-66660135 ATTACAGGTGTGAGCCACCGTGG - Intronic
991677474 5:69102187-69102209 ATTACAGGTGTGTCCCACCATGG + Intronic
991731955 5:69598215-69598237 ATTACAGGTGTGAGCCACCGTGG + Intergenic
991808389 5:70453359-70453381 ATTACAGGTGTGAGCCACCGTGG + Intergenic
991862997 5:71029642-71029664 ATTACAGGTGTGAGCCACCGTGG - Intergenic
992043693 5:72863341-72863363 ATTACAGGTGTGAGCCACCATGG - Intronic
992242280 5:74784643-74784665 ATTACAGGTGTGAGCCACCGTGG - Intronic
992736120 5:79723486-79723508 ATTACAGGTGTGAGCCACCATGG - Intronic
992958986 5:81939935-81939957 ATTACAGGTGTGAGCCACCACGG + Intergenic
992983174 5:82198531-82198553 ATTACAGGTGTGAGGCACCAAGG + Intronic
993930867 5:93937327-93937349 ATTACAGGTGTGAACCACCGCGG - Intronic
994746709 5:103687076-103687098 ATTACAGGTGTGAGCCACCATGG + Intergenic
995492959 5:112711579-112711601 ATTACAGGTGTGAGACACCATGG - Intronic
995657201 5:114439941-114439963 ATTCAAGGTGTTACCCACCAGGG - Intronic
996554393 5:124763047-124763069 ATTACAGGTGTGAGCCACCATGG - Intergenic
996581068 5:125032974-125032996 AATACAGGTGTTCCAGAGCCAGG - Intergenic
996794446 5:127329897-127329919 ATTACAGGTGTTACACACCCGGG + Intronic
997166298 5:131663014-131663036 ATTACAGGTGTGAGCCACCGCGG + Intronic
997606925 5:135181851-135181873 ATTACAGGTGTTCACCACCAGGG - Intronic
997722006 5:136086326-136086348 ATTACAGGTGTGAGCCACCATGG - Intergenic
998027902 5:138836122-138836144 ATTACAGGTGTGAGCCACCATGG + Intronic
999948373 5:156622157-156622179 ATTACAGGTGTGAGCCACCACGG - Intronic
1000238398 5:159385434-159385456 ATTACAGGTGTGAACCACCATGG + Intergenic
1000532089 5:162435830-162435852 ATTACAGGTGTGAGCCACCATGG + Intergenic
1001146264 5:169187382-169187404 ATTACAGGTGTGAGCCACCGCGG + Intronic
1002130582 5:177079131-177079153 ATTACAGGTGTAAGCCACCACGG - Intronic
1002208526 5:177581131-177581153 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1002293829 5:178217583-178217605 ATTACAGGTGTGAGTCACCGCGG - Intronic
1002362987 5:178688066-178688088 ATTACAGGTGTGAGCCACCAGGG - Intergenic
1002497631 5:179626064-179626086 ATTACAGGTGTGAGCCACCATGG + Intronic
1002736654 5:181394612-181394634 ATTACAGGTGTGAGCCACCATGG + Intergenic
1002748045 6:80211-80233 ATTACAGGTGTGAGCCACCATGG - Intergenic
1002990445 6:2233544-2233566 ATTACAGGTGTAAGCCACCACGG - Intronic
1003178817 6:3774412-3774434 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1003750250 6:9047518-9047540 ATTACATGTTTTAGAGACCCAGG + Intergenic
1003809125 6:9759795-9759817 ATTACAGGTGTGAGCCACCATGG - Intronic
1003826309 6:9956052-9956074 ATTACAGGTGTGAGCCAACCAGG + Intronic
1003918612 6:10810610-10810632 ATTACAGGTGTGAGCCACCACGG + Intronic
1004220207 6:13740403-13740425 ATTACAGGTGTAAGCCACCATGG - Intergenic
1004237778 6:13889891-13889913 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1004446330 6:15702375-15702397 ATTACAGGTGTGAGCCACCACGG + Intergenic
1004912223 6:20297557-20297579 ATTACAGGTGTGAGCCACCAAGG + Intergenic
1004931408 6:20466384-20466406 ATTACAGGTGTGAGCCACCATGG + Intronic
1005432768 6:25775699-25775721 ATTACAGGTGTGAGCCACCATGG + Intronic
1006120928 6:31805331-31805353 ATTACAGGTGTGAGCCACCATGG + Intronic
1007183724 6:39949748-39949770 ATTACAGGTGTGAGCCACCATGG - Intergenic
1007267594 6:40608957-40608979 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1008654419 6:53596988-53597010 ATTACAGGTGTGAGCCACCATGG + Intronic
1008958220 6:57239262-57239284 ATTACAGGTGTGAGCCACCATGG + Intergenic
1010111348 6:72237399-72237421 ATTACAGGTGTGAGCCACCAGGG - Intronic
1010159603 6:72837444-72837466 AGTACAGGTGTTACATACAAAGG - Intronic
1010800291 6:80167513-80167535 ATTACAGGTGTGAGCCACCGTGG + Intronic
1011117822 6:83913888-83913910 ATTATTAGTGTTACAAACCCAGG - Intronic
1011185093 6:84665915-84665937 ATTCCAGGTGTTACATAGCAAGG + Intergenic
1012973356 6:105754551-105754573 ATTACAGGTGTGAGCCACCATGG + Intergenic
1013199411 6:107878580-107878602 ATTACAGGTGTGAGCCACCATGG - Intronic
1014149449 6:118036832-118036854 ATTACAGGTGTAAGCCACCATGG + Intronic
1014388544 6:120831936-120831958 ATTACAGGTGTGAGCCACCATGG - Intergenic
1014722252 6:124931772-124931794 ATTACAGTTGTTACATATCTGGG - Intergenic
1015185788 6:130414156-130414178 ATTACAGGTGTGAGCCACCATGG - Intronic
1015564446 6:134553178-134553200 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1015628494 6:135206422-135206444 ATTACAGGTGTGAGCCACCACGG - Intronic
1016872050 6:148827347-148827369 ATTACAGGTGTGAACCACCGCGG - Intronic
1016935632 6:149447388-149447410 ATTACAGGTGTGCCCCACCACGG + Intergenic
1016946552 6:149539854-149539876 ATTACAGGTGTGAGCCACCGTGG - Intronic
1016953287 6:149602091-149602113 ATTACAGGTGTGAGCCACCATGG - Intronic
1017213894 6:151886765-151886787 ATTACAGGTGTGAGCCACCATGG - Intronic
1017360734 6:153566309-153566331 ATTACAGGTGTAAGCCACCATGG + Intergenic
1017515436 6:155152114-155152136 ATTACAGGTGTAAGCCACCACGG + Intronic
1018158147 6:161009255-161009277 ATTACAGGTGTGAGTCACCGTGG + Intronic
1018183833 6:161247708-161247730 ATTACAGGTGTAAGCCACCATGG - Intronic
1018576872 6:165268307-165268329 ATTACAGGTGTGAGCCACCATGG - Intergenic
1018796635 6:167190632-167190654 ATTACAGGTGTGAGCCACCGCGG + Intronic
1019241752 6:170670141-170670163 ATTACAGGTGTGAGCCACCATGG + Intergenic
1020154872 7:5714529-5714551 ATTACAGGCGTGAGCCACCCGGG + Intronic
1020277868 7:6635890-6635912 ATTACAGGTGTGACCCGCCTCGG + Intergenic
1020333049 7:7039720-7039742 ATTACAGGTGTGAGACTCCATGG + Intergenic
1020776274 7:12457946-12457968 ATTACAGGTGTGAGCCACCAAGG + Intergenic
1021861452 7:24910077-24910099 ATTACAGGTGTGAGCCACCGTGG + Intronic
1022066842 7:26867245-26867267 ATTACAGGTGTAACCCACCATGG - Intronic
1022075159 7:26961800-26961822 ATTACAGGTGTGAGCCACCATGG - Intronic
1022227496 7:28378617-28378639 ATTGCAGGTGTGACAAAGCCAGG - Intronic
1022518657 7:30991714-30991736 ATTACAGGTGTGAGCCACCGTGG + Intronic
1022681045 7:32546547-32546569 ATTACAGGTGTGAGCCACCGGGG - Intronic
1023783394 7:43680693-43680715 ATTACAGGTGTGAGCCACCATGG - Intronic
1024810522 7:53206545-53206567 ATTACAGGTGTGAGCCACCATGG - Intergenic
1024933125 7:54685475-54685497 ATTACAGGTGTGAGCCACCATGG + Intergenic
1025779245 7:64584929-64584951 ATTACAGGTGTGAGCCACCATGG + Intergenic
1025801249 7:64788692-64788714 ATTACAGGCGTGAGCCACCCCGG - Intergenic
1026370575 7:69694503-69694525 ATTACAGGTGTGAGCCACCATGG - Intronic
1026704110 7:72674868-72674890 ATTACAGGTGTGAGCCACCATGG + Intronic
1026831828 7:73615081-73615103 ATTACAGGTGTGAGCCACCGTGG + Intronic
1026844069 7:73687660-73687682 ATTATAGGTGTGAGCCACCCTGG + Intronic
1026882814 7:73918344-73918366 ATTACAGGTGTGAACCACCATGG + Intergenic
1027003463 7:74671706-74671728 ATTACAGGCGTGAGACACCATGG - Intronic
1027026024 7:74852085-74852107 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1027061732 7:75092025-75092047 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1027141266 7:75659383-75659405 ATTACAGGTGTAAGCCACCATGG - Intronic
1027172505 7:75882596-75882618 ATTACAGGTGTGAGCCACCGTGG + Intronic
1027182019 7:75947566-75947588 ATTACAGGCGTTAGCCACCACGG + Intronic
1027230720 7:76270536-76270558 ATTACAGGTGTGAGCCACCATGG - Intronic
1027453876 7:78363218-78363240 ATTACAGGTGTGAGCCACCGCGG - Intronic
1027830035 7:83165703-83165725 ATTACAGGTGTGAGCCACCAGGG - Intergenic
1028546491 7:92008094-92008116 ATTACAGGTGTGAGCCACCACGG - Intronic
1028567395 7:92247491-92247513 CTCACAGATGTTACACACCTTGG + Intronic
1028817177 7:95159648-95159670 ATTACAGGTGTGAGCCACCACGG - Intronic
1029194806 7:98797804-98797826 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1029241882 7:99168910-99168932 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1029250294 7:99231729-99231751 ATTACAGGTGTGAGCCACCTTGG - Intergenic
1029680522 7:102105784-102105806 ATTACAGGTGTGAGCCACCACGG + Intronic
1029981003 7:104879141-104879163 ATTACAGGTGTGAGCCACCATGG - Intronic
1031253267 7:119414285-119414307 ATTACAGGTGTGAGCCACCTCGG - Intergenic
1032339213 7:131055250-131055272 ATTACAGGTGTGAGCCACCATGG - Intergenic
1032571843 7:133009088-133009110 ATTACAGGTGTGAGCCACCGTGG - Intronic
1032635566 7:133704221-133704243 ATTACAGGTGTGAGCCACCATGG + Intronic
1032798861 7:135302040-135302062 ATTACAGCTGCTGCCCACCCTGG + Intergenic
1032954903 7:136959637-136959659 ATTACAGGTGTGAGCCACCGTGG - Intronic
1033306202 7:140227597-140227619 ATTACAGGTGTGAGCCACCATGG - Intergenic
1033398705 7:141000741-141000763 ATTACAGGCGTGAGCCACCCGGG - Intergenic
1033964518 7:146958684-146958706 ATTACAGGTGTGAGCCACCACGG + Intronic
1034044765 7:147916167-147916189 ATAACAGGTGTTTCACTCACAGG - Intronic
1034238726 7:149593064-149593086 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1034253222 7:149709007-149709029 ATTACAGGTGTGAGCCACCAGGG - Intergenic
1034453867 7:151153834-151153856 ATTACAGGTGTGAGCCACCATGG + Intronic
1034573678 7:151979385-151979407 ATTACAGGTGTGAGCCACCACGG + Intronic
1034679366 7:152916763-152916785 ATTACAGGTGTGAAACACCATGG + Intergenic
1035506364 8:137955-137977 ATTACAGGTGTGAGCCACCATGG - Intergenic
1035978042 8:4335175-4335197 ATTACAGGTGTGAGCCACCATGG + Intronic
1036271142 8:7303951-7303973 ATTACAGGTGTGAGCCACCATGG + Intergenic
1036350207 8:8006392-8006414 ATTACAGGTGTGAGCCACCATGG - Intergenic
1036851524 8:12205073-12205095 ATTACAGGTGTGAACCACCATGG + Intergenic
1036872889 8:12447347-12447369 ATTACAGGTGTGAACCACCATGG + Intergenic
1036943139 8:13070319-13070341 ATTACAGGTGTGAAACACTGAGG - Intergenic
1036954384 8:13171659-13171681 ATTACAGGTGTGAACCACCACGG + Intronic
1036977869 8:13434951-13434973 ATTACAGGCGTGACCCCCCCCGG + Intronic
1037120020 8:15272585-15272607 ATTACAGGTGTGAGCCACCATGG - Intergenic
1037889665 8:22617121-22617143 ATTACAGGTGTGAGCCACCATGG + Intronic
1037983899 8:23274495-23274517 ATTACAGGTGTGAGCCACCTCGG - Intronic
1038121340 8:24619785-24619807 ATTACAGGTGTGAGCCACCAGGG - Intergenic
1038743616 8:30236988-30237010 ATTACAGGTGTAAGCCACCGCGG - Intergenic
1038763834 8:30409330-30409352 ATTACAGGTGTGAACCACCATGG + Intronic
1038950642 8:32410438-32410460 ATTACAGGTGTGAGTCACCATGG + Intronic
1039208031 8:35178846-35178868 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1039737203 8:40345474-40345496 ATTACAAGTGTTATAGGCCCAGG - Intergenic
1039785802 8:40833294-40833316 ATTACAGGTGTGAGCCACCACGG - Intronic
1039938727 8:42070531-42070553 ATTACAGGTGTGAGCCACCAGGG - Intergenic
1039970060 8:42314499-42314521 ATTACAGGTGTGAGCCACCACGG - Intronic
1040515221 8:48129062-48129084 ATTACAGGTGTTCACCACCATGG + Intergenic
1041055678 8:53983823-53983845 ATTACAGGTGTGAGCCACCACGG - Intronic
1041542526 8:59002245-59002267 ATTACAGGTGTGAGCCACCACGG + Intronic
1041661764 8:60407819-60407841 ATTACAGGTGTGAGCCACCATGG - Intergenic
1041674235 8:60521893-60521915 ATTACAGGTGTGAGCCACCGCGG + Intronic
1042612169 8:70610975-70610997 ATTACAGGTGTGAACCACCATGG + Intronic
1042648412 8:71012810-71012832 AGTACAGTAGTTAAACACCCAGG - Intergenic
1042926804 8:73975468-73975490 ATTACAGGTGTAAGCCACCACGG + Intronic
1043654280 8:82642217-82642239 ATTACAGGCGTGAGCCACCCTGG - Intergenic
1043821915 8:84877211-84877233 ATTACAGGTGTGAGCCACCGCGG - Intronic
1044992344 8:97807291-97807313 ATTACAGGTGTGAGCCACCGTGG - Intronic
1045503526 8:102761534-102761556 ATTACAGGTGTGAGCTACCCCGG + Intergenic
1045725746 8:105171110-105171132 ATTACAGGTGTGAGCCACCAAGG + Intronic
1046221052 8:111215159-111215181 ATTACAGGTGTGAGCCACCACGG - Intergenic
1047667212 8:127105233-127105255 ATTACAGGTGTGAGCCACCGAGG - Intergenic
1048024340 8:130570869-130570891 ATTACAGGTGTGATCCACCATGG + Intergenic
1048565536 8:135592923-135592945 ATTACAGGAGTGAGACACCGAGG - Intronic
1048633784 8:136273479-136273501 ATTACAGGTGTTAGCCACCCCGG + Intergenic
1049723162 8:144130697-144130719 AGTCCAGGTGTTACTTACCCAGG + Intergenic
1050481426 9:6091338-6091360 ATTACAGGTATGAGCCACCCTGG - Intergenic
1050633640 9:7586464-7586486 ATTACAGGTGTGAGACACCGTGG + Intergenic
1051141313 9:13981983-13982005 ATTACAGGTGTGAGCCACCACGG + Intergenic
1052463300 9:28795105-28795127 ATTACAGGTGTGAGCCACCACGG + Intergenic
1052903256 9:33813424-33813446 ATTACAGGTGTGAGCCACCATGG - Intergenic
1053349251 9:37402004-37402026 ATTACAGGTGTGAGCCACCATGG - Intergenic
1053488147 9:38477627-38477649 ATTACAGGTGTGAGCCACCATGG - Intergenic
1055032962 9:71789384-71789406 ATTACAGGTGTGAACCACCATGG - Intronic
1055305309 9:74923395-74923417 ATTACAGGTGTGAATCACCATGG - Intergenic
1055502984 9:76920271-76920293 ATTACAGGTGTGACCCACTATGG - Intergenic
1055725269 9:79221190-79221212 ATTACAGGGGTTAAAACCCCTGG + Intergenic
1056639326 9:88357226-88357248 ATTACAGGTGTGAGCCACCACGG + Intergenic
1056648103 9:88432459-88432481 ATTACAGGTGTGAGCCACCCTGG + Intronic
1057057731 9:91976891-91976913 ATTACAGGTGTGAGCCACCATGG - Intergenic
1057273983 9:93666406-93666428 TTTACATGTGTTACACACTGGGG + Intronic
1058466883 9:105237711-105237733 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1058810341 9:108633104-108633126 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1059333823 9:113555736-113555758 ATTACAGGCGTGAGCCACCCTGG + Intronic
1059615544 9:115947159-115947181 ATTACAGGTGTAAGGCACCGCGG - Intergenic
1060505234 9:124192576-124192598 ATTACAGGTGTGAGCCACCATGG + Intergenic
1060847475 9:126848817-126848839 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1061100701 9:128490069-128490091 ATTACAGGTGTGAGCCACCATGG - Intronic
1061138232 9:128748843-128748865 ATTACAGGTGTGAGCCACCGTGG + Intronic
1061157214 9:128871041-128871063 ATTACAGGTGTGAGTCACCGCGG - Intronic
1061205927 9:129163412-129163434 ATAACTGGTATTACACAGCCAGG - Intergenic
1061504284 9:131022355-131022377 ATTACAGGTGTGAGCCACCACGG + Intronic
1061618597 9:131796197-131796219 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1062545204 9:137059476-137059498 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1203601943 Un_KI270748v1:19375-19397 ATTACAGGTGTGAGCCACCATGG + Intergenic
1185554177 X:1007451-1007473 ATTACAGGTGTGAGCCACCACGG - Intergenic
1185664806 X:1757224-1757246 ATTACAGGTGTGAGCCACCACGG - Intergenic
1185667601 X:1779194-1779216 ATAACGGGTGTTACACACAGTGG - Intergenic
1185749178 X:2597009-2597031 ATTCAAAGTGTGACACACCCAGG + Intergenic
1186217041 X:7311572-7311594 ATTACAGGTGTGAGCCACCATGG - Intronic
1186650070 X:11549889-11549911 ATTACCAGTGCTACACAACCAGG - Intronic
1187166763 X:16811619-16811641 ATTACAGGTGTGAGCCACCGTGG + Intronic
1187360176 X:18618693-18618715 ATTACAGGTGTGAGCCACCGCGG - Intronic
1189486203 X:41434399-41434421 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1190070833 X:47277923-47277945 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1190269152 X:48848827-48848849 ATTACAGGTGTGAGCCACCATGG + Intergenic
1190693069 X:52928167-52928189 ATTGCAGGTGGAACATACCCTGG + Intronic
1191132330 X:57027778-57027800 ATTACAAGTGTGAGACACCATGG + Intergenic
1191180280 X:57554850-57554872 ATTACAGGTGTGAGCCACCATGG + Intergenic
1191888031 X:65909533-65909555 ATTACAGGTGTTAGCCACTATGG - Intergenic
1192565225 X:72157982-72158004 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1194248618 X:91545000-91545022 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1194744396 X:97612585-97612607 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1194835463 X:98676536-98676558 ATTACAGGTGTGAACCACCACGG - Intergenic
1196344283 X:114634534-114634556 ATTACAGGTGTAAGCCACCATGG - Intronic
1196843146 X:119877148-119877170 ATTACAGGTGTGAGCCACCGGGG + Intergenic
1197756785 X:130001360-130001382 ATTACAGGTGTGAGCCACCGTGG + Intronic
1198382857 X:136100490-136100512 ATTACAGGTGTGAGCCACCCTGG - Intergenic
1198755226 X:139975376-139975398 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1198805987 X:140495322-140495344 ATTACAGGTGTGAGCCACCATGG - Intergenic
1198865031 X:141113430-141113452 ATTACAGGTGTGAGCCACCGCGG - Intergenic
1198897654 X:141473958-141473980 ATTACAGGTGTGAGCCACCGCGG + Intergenic
1199147403 X:144384904-144384926 ATTACAGGTGCCTCACATCCTGG + Intergenic
1200383074 X:155860027-155860049 ATTACAGGTGTGAGCCACCGTGG + Intergenic
1200567627 Y:4786514-4786536 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1201309531 Y:12583783-12583805 ATTACAGGTGTGAGCCACCATGG - Intergenic
1201486123 Y:14496279-14496301 ATTACAGGTGTGAGTCACCGTGG + Intergenic
1201594151 Y:15648741-15648763 ATTACAGGTGTGAGTCACCATGG + Intergenic
1201676808 Y:16595177-16595199 ATTACAGGTGTGAGCCACCGTGG - Intergenic
1202299762 Y:23399960-23399982 ATTACAGGTGTGAGCCACCATGG - Intergenic
1202571047 Y:26270638-26270660 ATTACAGGTGTGAGCCACCATGG + Intergenic
1202581228 Y:26382788-26382810 ATTACAGGTGTGAGCCACCATGG - Intergenic